New upstream version 0.9+dfsg

language: perl

sudo: false

addons:

  apt:

    packages:

    - hmmer

    - bedtools

perl:

  - "5.26"

install:

  - "export PATH=$PWD/bin:$PATH"

  - "sed -i~ -e 's/-name+/-name/' bin/barrnap"

script:

  - "barrnap --version"

  - "barrnap --help"

  - "barrnap --citation"

  - "! barrnap --doesnotexist"

  - "barrnap 2>&1 | grep 'ERROR: No input file'"

  - "barrnap -q --kingdom bac  examples/bacteria.fna"

  - "barrnap -q --kingdom arc  examples/bacteria.fna"

  - "barrnap -q --kingdom mito examples/mitochondria.fna"

  - "barrnap -q --kingdom euk  examples/fungus.fna"

  - "! barrnap examples/empty.fna"

  - "! barrnap examples/null.fna"

  - "barrnap -q examples/small.fna | grep 16S_rRNA"

  - "barrnap -q < examples/small.fna | grep 16S_rRNA"

  - "barrnap -q - < examples/small.fna | grep 16S_rRNA"

  - "barrnap examples/nohits.fna 2>&1 | grep 'Found 0 '"  

  - "barrnap --threads 2 examples/small.fna"

  - "barrnap -q --incseq examples/small.fna | grep '^>'"

  - "barrnap -q --outseq hits.fa < examples/small.fna && head -n3 hits.fa"

[![Build Status](https://travis-ci.org/tseemann/barrnap.svg?branch=master)](https://travis-ci.org/tseemann/barrnap) [![License: GPL v3](https://img.shields.io/badge/License-GPL%20v3-blue.svg)](https://www.gnu.org/licenses/gpl-3.0) [](#lang-au)

# Barrnap

BAsic Rapid Ribosomal RNA Predictor

## Author

Torsten Seemann - torsten.seemann@gmail.com - @torstenseemann

## Description

Barrnap predicts the location of ribosomal RNA genes in genomes.

It supports bacteria (5S,23S,16S), archaea (5S,5.8S,23S,16S),

mitochondria (12S,16S) and eukaryotes (5S,5.8S,28S,18S).

metazoan mitochondria (12S,16S) and eukaryotes (5S,5.8S,28S,18S).

It takes FASTA DNA sequence as input, and write GFF3 as output.

It uses the new NHMMER tool that comes with HMMER 3.1 for HMM searching in RNA:DNA style.

NHMMER binaries for 64-bit Linux and Mac OS X are included and will be auto-detected.

It uses the new `nhmmer` tool that comes with HMMER 3.1 for HMM searching in RNA:DNA style.

Multithreading is supported and one can expect roughly linear speed-ups with more CPUs.

## Download

* Tarballs: https://github.com/tseemann/barrnap/releases/

* Source: https://github.com/tseemann/barrnap

## Install

    % cd $HOME

    % tar zxvf barrnap-0.X.tar.gz

    % echo "PATH=$PATH:$HOME/barrnap-0.x/bin" >> .bashrc

    (logout and log back in)

## Installation

### Requirements

* [Perl 5.xx](https://dev.perl.org/perl5/) (core modules only)

* [nhmmer](https://hmmer.org/) (part of HMMER 3.x)

* [bedtools](http://bedtools.readthedocs.io/en/latest/)

### Conda

Install [Conda](https://conda.io/docs/) or [Miniconda](https://conda.io/miniconda.html):

```

conda -c bioconda -c conda-forge install barrnap

barrnap --version

```

### Homebrew

Install [HomeBrew](http://brew.sh/) (Mac OS X) or [LinuxBrew](http://brew.sh/linuxbrew/) (Linux).

```

brew install brewsci/bio/barrnap

barrnap --help

```

### Source

This will install the latest version direct from Github. 

You'll need to add the `bin` directory to your PATH.

```

cd $HOME

tar zxvf barrnap-0.X.tar.gz

barrnap-0.X/barrnap -h

```

## Usage

```

% barrnap --quiet examples/small.fna

##gff-version 3

    P.marinus	barrnap:0.7	rRNA	353314	354793	0	+	.	Name=16S_rRNA;product=16S ribosomal RNA

    P.marinus	barrnap:0.7	rRNA	355464	358334	0	+	.	Name=23S_rRNA;product=23S ribosomal RNA

    P.marinus	barrnap:0.7	rRNA	358433	358536	7.5e-07	+	.	Name=5S_rRNA;product=5S ribosomal RNA

P.marinus	barrnap:0.8	rRNA	353314	354793	0	+	.	Name=16S_rRNA;product=16S ribosomal RNA

P.marinus	barrnap:0.8	rRNA	355464	358334	0	+	.	Name=23S_rRNA;product=23S ribosomal RNA

P.marinus	barrnap:0.8	rRNA	358433	358536	7.5e-07	+	.	Name=5S_rRNA;product=5S ribosomal RNA

% barrnap -q -k mito examples/mitochondria.fna 

##gff-version 3

    AF346967.1	barrnap:0.7	rRNA	643	1610	.	+	.	Name=12S_rRNA;product=12S ribosomal RNA

    AF346967.1	barrnap:0.7	rRNA	1672	3228	.	+	.	Name=16S_rRNA;product=16S ribosomal RNA

AF346967.1	barrnap:0.8	rRNA	643	1610	.	+	.	Name=12S_rRNA;product=12S ribosomal RNA

AF346967.1	barrnap:0.8	rRNA	1672	3228	.	+	.	Name=16S_rRNA;product=16S ribosomal RNA

% barrnap -o rrna.fa < contigs.fa > rrna.gff

% head -n 3 rrna.fa

>16S_rRNA::gi|329138943|tpg|BK006945.2|:455935-456864(-)

ACGGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATT

TATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGACGTTTTCATTA

```

## Options

### General

* `--help` show help and exit

* `--version` print version in form `barrnap X.Y` and exit 

* `--citation` print a citation and exit

### Search

* `--kingdom` is the database to use: Bacteria:`bac`, Archaea:`arc`, Eukaryota:`euk`, Metazoan Mitochondria:`mito`

* `--threads` is how many CPUs to assign to `nhmmer` search

* `--evalue` is the cut-off for `nhmmer` reporting, before further scrutiny

* `--lencutoff` is the proportion of the full length that qualifies as `partial` match

* `--reject` will not include hits below this proportion of the expected length

### Output

* `--quiet` will not print any messages to `stderr`

* `--incseq` will include the full input sequences in the output GFF

* `--outseq` creates a FASTA file with the hit sequences

## Caveats

Barrnap does not do anything fancy. It has HMM models for each different rRNA gene. 

They are built from full length seed alignments. 

## Requirements

* Perl >= 5.6

* HMMER >= 3.1b

## License

Barrnap is free software, released under the GPL (version 3).

## Comparison with RNAmmer

Barrnap is designed to be a substitute for RNAmmer. It was motivated by

my desire to remove <A HREF="https://github.com/tseemann/prokka">Prokka's</A> dependency on RNAmmer

which is encumbered by a free-for-academic sign-up license, and by RNAmmer's

dependence on legacy HMMER 2.x which conflicts with HMMER 3.x that most people are using now.

Barrnap is designed to be a substitute for [RNAmmer](http://www.cbs.dtu.dk/services/RNAmmer/). 

It was motivated by my desire to remove [Prokka's](https://github.com/tseemann/prokka)

dependency on RNAmmer which is encumbered by a free-for-academic sign-up

license, and by RNAmmer's dependence on legacy HMMER 2.x which conflicts

with HMMER 3.x that most people are using now.

RNAmmer is more sophisticated than Barrnap, and more accurate because it uses HMMER 2.x in glocal alignment mode whereas NHMMER 3.x currently only supports local alignment (Sean Eddy expects glocal to be supported in 2014). In practice, Barrnap will find all the typical rRNA genes in a few seconds (in bacteria), but may get the end points out by a few bases and will probably miss wierd rRNAs. The HMM models it uses are derived from Rfam, Silva and RefSeq.

RNAmmer is more sophisticated than Barrnap, and more accurate because it

uses HMMER 2.x in glocal alignment mode whereas NHMMER 3.x currently only

supports local alignment (Sean Eddy expected glocal to be supported in 2014, 

but it still isn't available in 2018). 

In practice, Barrnap will find all the typical rRNA genes in a few seconds

(in bacteria), but may get the end points out by a few bases and will

probably miss wierd rRNAs.  The HMM models it uses are derived from Rfam,

Silva and RefSeq.

## Data sources for HMM models

<pre>

```

Bacteria (70S)  

        LSU 50S

                5S      RF00001

                28S     SILVA-LSU-Euk

        SSU 40S

                18S     RF01960

        Mito

Metazoan Mito

                12S     RefSeq (MT-RNR1, s-rRNA, rns)

                16S     RefSeq (MT-RNR2, l-rRNA, rnl)       

```

## Models I would like to add

TODO: [Sajeet Haridas]

Fungi

```

Fungi	[Sajeet Haridas]

        LSU 35S ?

                5S

                5.8S

                15S 

                21S (multiple exons)

TODO:

Apicoplast [http://www.ncbi.nlm.nih.gov/nuccore/U87145.2]

                LSU ~2500bp 28S ?

                SSU ~1500bp 16S ?

Plastid [Shaun Jackman]

	?

</pre>

Plant [Shaun Jackman]

	Mito [https://www.ncbi.nlm.nih.gov/nucleotide?cmd=Retrieve&dopt=GenBank&list_uids=26556996]	

		5S	~118 bp  ?	rrn5 	(use RF00001 ?)

		18S	~1935 bp ?	rrn18	(use RF01960 ?)

		26S	~2568 bp ?	rrn26   

```

## Where does the name come from?

The project was originally spawned at CodeFest 2013 in Berlin, Germany 

by Torsten Seemann and Tim Booth.

## License

* Barrnap: [GPLv3](https://raw.githubusercontent.com/tseemann/barrnap/master/LICENSE)

* Rfam: [CC0](https://raw.githubusercontent.com/tseemann/barrnap/master/LICENSE.Rfam)

* SILVA: [Free for academic use](https://raw.githubusercontent.com/tseemann/barrnap/master/LICENSE.SILVA)

## Author

Torsten Seemann

#!/usr/bin/env perl

use strict;

use warnings;

use Time::Piece;

use List::Util qw(max);

use FindBin;

use File::Temp;

# . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 

# global variables

my $VERSION = "0.9";

my $EXE = $FindBin::RealScript;

my $VERSION = "0.8";

my $DESC = "rapid ribosomal RNA prediction";

my $AUTHOR = 'Torsten Seemann <torsten.seemann@gmail.com>';

my $AUTHOR = 'Torsten Seemann';

my $URL = 'https://github.com/tseemann/barrnap';

my $DBDIR = "$FindBin::RealBin/../db";

my $OPSYS = $^O;

# . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 

# command line options

my(@Options, $quiet, $kingdom, $threads, $evalue, $lencutoff, $reject, $incseq);

my(@Options, $quiet, $kingdom, $threads, $evalue, $lencutoff, $reject, $incseq, $outseq);

setOptions();

# . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 

msg("Adding $BINDIR to end of PATH");

$ENV{PATH} .= ":$BINDIR";

my($NHMMER) = qx(which -a nhmmer 2> /dev/null);

$NHMMER or err("Could not find 'nhmmer' executable in PATH");

chomp $NHMMER;

msg("Using HMMER binary: $NHMMER");

msg("Checking for dependencies:");

require_exe('nhmmer', 'bedtools');

$threads > 0 or err("Invalid --threads $threads");

msg("Will use $threads threads");

msg("Will reject genes < $reject of expected length.");

my $kdom = $KINGDOM{ lc substr($kingdom,0,1) } or

  err("I don't recognise --kingdom '$kingdom'. Try: bac arc euk mito");

  err("I don't recognise --kingdom '$kingdom'. Try:", values(%KINGDOM) );

my $hmmdb = "$DBDIR/$kdom.hmm";

err("Can't find database: $hmmdb") unless -r $hmmdb;

msg("Using database: $hmmdb");

# . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 

# run the external command

# check if user is piping to STDIN

# nhmmer needs to fseek() so we make a temp fasta file 

my $fasta = shift @ARGV;

$fasta && -r $fasta or err("Usage: $EXE <file.fasta>");

my $tmpfh;

if (defined($fasta) && $fasta eq '-'  or  !defined($fasta) && !-t \*STDIN) {

  $tmpfh = File::Temp->new(UNLINK=>1);

  msg("Copying STDIN to a temporary file:", $tmpfh->filename);

  while (<STDIN>) {

    print $tmpfh $_;

  }

  $fasta = $tmpfh->filename;

}

$fasta && -r $fasta or err("No input file on command line or stdin");

# . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 

# run the external command

msg("Scanning $fasta for $kdom rRNA genes... please wait");

my $cmd = "$NHMMER --cpu $threads -E $evalue --w_length $MAXLEN  -o /dev/null --tblout /dev/stdout \Q$hmmdb\E \Q$fasta\E";

my $opts = "--cpu $threads -E $evalue --w_length $MAXLEN -o /dev/null --tblout /dev/stdout";

my $cmd = "nhmmer $opts '$hmmdb' '$fasta'";

msg("Command: $cmd");

my @hits = qx($cmd 2>&1);

# . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 

# process the output

my %hitname;

my @feat;

my @bed;

HIT: 

foreach (@hits) {

  chomp;

  my @x = split ' ', $_;

  err("bad line in nhmmer output - @x") unless defined $x[6] and $x[6] =~ m/^\d+$/;

  # massage to GFF

  my($begin,$end,$strand) = $x[6] < $x[7] ? ($x[6],$x[7],'+') : ($x[7],$x[6],'-');

  my($seqid, $gene, $prod) = ($x[0], $x[2], $x[2]);

  my $score = defined $x[12]  ? $x[12] : '.';

  # record hits for --outseq retrieval later

  $hitname{"$seqid/$begin:$end($strand)"} = $prod;

  # check if hit makes sense to us

  exists $LENG{$gene} or err("Detected unknown gene '$gene' in scan, aborting.");

    $prod .= " (partial)";

  }

  # keep track of good hits for retrievel later

  push @bed, [ $seqid, $begin-1, $end, $gene, 100, $strand ];

  msg("Found:", $gene, $seqid, "L=$len/$LENG{$gene}", "$begin..$end", $strand, $prod);

  my $tags = "Name=$gene;product=$prod";

  $tags .= ";note=$note" if $note;

  print while (<FASTA>);  # `cat $fasta`

}

if ($outseq) {

  msg("Writing hit sequences to: $outseq");

  my $bed = File::Temp->new();

  for my $b (@bed) {

    print $bed join("\t", @$b),"\n";

  }

  $bed->seek(0, SEEK_END); # rewind

  my $cmd = "bedtools getfasta -s -name+ -fo '$outseq' -fi '$fasta' -bed '".$bed->filename."'";

  msg("Running: $cmd");

  system($cmd);

}

# . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 

# final cleanup

msg("Done.");

#----------------------------------------------------------------------

sub require_exe {

  for my $exe (@_) {

    my($which) = qx(which $exe 2> /dev/null);

    $which or err("Can not find required '$exe' in PATH");

    chomp $which;

    msg("Found $exe - $which");

  }

}

#----------------------------------------------------------------------

sub revcom {

  my($s) = @_;

  $s = reverse($s);

  $s =~ tr/ATCGatcg/TAGCtagc/;

  return $s;

}

#----------------------------------------------------------------------

sub msg {

  return if $quiet;

  my $t = localtime;

  my $line = "[".$t->hms."] @_\n";

  my $line = "[$EXE] @_\n";

  print STDERR $line;

}

#----------------------------------------------------------------------

sub err {

  $quiet=0;

  msg(@_);

  msg("ERROR:", @_);

  exit(2);

}

#----------------------------------------------------------------------

sub version {

  print STDERR "$EXE $VERSION\n";

  exit;

}

#----------------------------------------------------------------------

sub show_citation {

  print STDERR << "EOCITE";

If you use Barrnap in your work, please cite:

    Seemann T (2013)

    Seemann T

    $EXE $VERSION : $DESC

    $URL

    {OPT=>"help",    VAR=>\&usage,             DESC=>"This help"},

    {OPT=>"version", VAR=>\&version,           DESC=>"Print version and exit"},

    {OPT=>"citation",VAR=>\&show_citation,     DESC=>"Print citation for referencing $EXE"},

    {OPT=>"kingdom=s", VAR=>\$kingdom,  DEFAULT=>'bac', 

       DESC=>"Kingdom: ".join(' ', values %KINGDOM) },

    {OPT=>"kingdom=s", VAR=>\$kingdom,  DEFAULT=>'bac', DESC=>"Kingdom: ".join(' ', values %KINGDOM) },

    {OPT=>"quiet!",  VAR=>\$quiet, DEFAULT=>0, DESC=>"No screen output"},

    {OPT=>"threads=i",  VAR=>\$threads, DEFAULT=>8,  DESC=>"Number of threads/cores/CPUs to use"},

    {OPT=>"threads=i",  VAR=>\$threads, DEFAULT=>1,  DESC=>"Number of threads/cores/CPUs to use"},

    {OPT=>"lencutoff=f",VAR=>\$lencutoff, DEFAULT=>0.8, DESC=>"Proportional length threshold to label as partial"},

    {OPT=>"reject=f",VAR=>\$reject, DEFAULT=>0.5, DESC=>"Proportional length threshold to reject prediction"},

    {OPT=>"reject=f",VAR=>\$reject, DEFAULT=>0.25, DESC=>"Proportional length threshold to reject prediction"},

    {OPT=>"evalue=f",VAR=>\$evalue, DEFAULT=>1E-6, DESC=>"Similarity e-value cut-off"},

    {OPT=>"incseq!",  VAR=>\$incseq, DEFAULT=>0, DESC=>"Include FASTA input sequences in GFF3 output"},

    {OPT=>"incseq!",  VAR=>\$incseq, DEFAULT=>0, DESC=>"Include FASTA _input_ sequences in GFF3 output"},

    {OPT=>"outseq=s",  VAR=>\$outseq, DEFAULT=>'', DESC=>"Save rRNA hit seqs to this FASTA file"},

  );

  (!@ARGV) && (usage());

#  (!@ARGV) && (usage(1));

  &GetOptions(map {$_->{OPT}, $_->{VAR}} grep { ref } @Options) || usage();

  &GetOptions(map {$_->{OPT}, $_->{VAR}} grep { ref } @Options) || usage(1);

  # Now setup default values.

  foreach (@Options) {

#----------------------------------------------------------------------

sub usage {

  print STDERR "Synopsis:\n  $EXE $VERSION - $DESC\n";

  print STDERR "Author:\n  $AUTHOR\n";

  print STDERR "Usage:\n  $EXE [options] <chromosomes.fasta>\n";

  my($exitcode) = @_;

  $exitcode = 0 if $exitcode eq 'help'; # what gets passed by getopt func ref

  $exitcode ||= 0;

  select STDERR if $exitcode; # write to STDERR if exitcode is error

  print "Synopsis:\n  $EXE $VERSION - $DESC\n";

  print "Author:\n  $AUTHOR\n";

  print "Usage:\n";

  print "  $EXE [options] chr.fa\n";

  print "  $EXE [options] < chr.fa\n";

  print "  $EXE [options] - < chr.fa\n";

  foreach (@Options) {

    if (ref) {

      my $def = defined($_->{DEFAULT}) ? " (default '$_->{DEFAULT}')" : "";

      $opt =~ s/=s$/ [X]/; 

      $opt =~ s/=i$/ [N]/;

      $opt =~ s/=f$/ [n.n]/;

      printf STDERR "  --%-15s %s%s\n", $opt, $_->{DESC}, $def;

      printf "  --%-15s %s%s\n", $opt, $_->{DESC}, $def;

    }

    else {

      print STDERR "$_\n";

      print "$_\n";

    }      

  }

  exit(1);

  exit($exitcode);

}

#----------------------------------------------------------------------