.github/workflows/main.yml

+name: CI
+
+on: [push, pull_request]
+
+jobs:
+  build:
+
+    runs-on: ubuntu-latest
+
+    steps:
+    - uses: actions/checkout@v1
+    - name: Install samtools
+      run: sudo apt-get install -y samtools 
+    - name: Compile and test Bedtools
+      run: make -j8 && make test
+    - name: Compile static binary
+      run:  make -j8 static
+    - uses: actions/upload-artifact@v1
+      with:
+          name: bedtools.static
+          path: bin/bedtools.static

.travis.yml

-os:
-  - osx
-  - linux
-language: cpp
-compiler:
-  - gcc
-  - clang
-addons:
-  apt:
-    packages:
-    - samtools
-    - tabix
-script: make test

Makefile

@@ -16,6 +16,7 @@ CCPREFIX =
 else
 CCPREFIX = @
 endif
+
 OBJ_DIR	= obj
 BIN_DIR	= bin
 SRC_DIR	= src
@@ -131,6 +132,8 @@ ALL_LIBS     = $(BT_LIBS) $(LIBS)
 
 all: print_banner $(BIN_DIR)/bedtools $(BIN_DIR)/intersectBed
 
+static: print_banner $(BIN_DIR)/bedtools.static
+
 BUILT_OBJECTS = $(OBJ_DIR)/bedtools.o
 # Include all the Makefile fragments, which add to $(BUILT_OBJECTS)
 include $(patsubst %,%/Makefile.frag,$(SUBDIRS) $(UTIL_SUBDIRS))
@@ -148,7 +151,7 @@ DEPFLAGS = -MT $@ -MMD -MP -MF $*.Td
 
 define CXX_COMPILE
 @echo "  * compiling $<"
-$(CCPREFIX)$(CXX) $(ALL_CXXFLAGS) $(ALL_CPPFLAGS) $(DEPFLAGS) -c -o $@ $<
+$(CCPREFIX) $(CC_WRAPPER) $(CXX) $(ALL_CXXFLAGS) $(ALL_CPPFLAGS) $(DEPFLAGS) -c -o $@ $<
 @mv -f $*.Td $*.d
 endef
 
@@ -170,7 +173,12 @@ $(BUILT_OBJECTS): | $(OBJ_DIR)
 
 $(BIN_DIR)/bedtools: autoversion $(BUILT_OBJECTS) $(HTSDIR)/libhts.a | $(BIN_DIR)
 	@echo "- Building main bedtools binary."
-	$(CCPREFIX)$(CXX) $(ALL_LDFLAGS) -o $(BIN_DIR)/bedtools $(BUILT_OBJECTS) $(HTSDIR)/libhts.a $(ALL_LIBS)
+	$(CCPREFIX) $(CC_WRAPPER) $(CXX) $(ALL_LDFLAGS) -o $(BIN_DIR)/bedtools $(BUILT_OBJECTS) $(HTSDIR)/libhts.a $(ALL_LIBS)
+	@echo "done."
+
+$(BIN_DIR)/bedtools.static: autoversion $(BUILT_OBJECTS) $(HTSDIR)/libhts.a | $(BIN_DIR)
+	@echo "- Building main bedtools binary."
+	$(CCPREFIX) $(CC_WRAPPER) $(CXX) -static $(ALL_LDFLAGS) -o $(BIN_DIR)/bedtools.static $(BUILT_OBJECTS) $(HTSDIR)/libhts.a $(ALL_LIBS)
 	@echo "done."
 
 $(BIN_DIR)/intersectBed: | $(BIN_DIR)

debian/changelog

+bedtools (2.29.2+dfsg-1) UNRELEASED; urgency=medium
+
+  * Team upload.
+  * New upstream version
+
+  * BLOCKER: Tests for 'intersect' fail
+             https://github.com/arq5x/bedtools2/issues/814
+
+ -- Steffen Moeller <moeller@debian.org>  Sat, 18 Jan 2020 01:44:47 +0100
+
 bedtools (2.29.0+dfsg-2) unstable; urgency=medium
 
   * Fix Build-Depends (s/python/python3/) and replace remaining references

debian/patches/2to3.patch

@@ -3,16 +3,18 @@ Bug-Debian: https://bugs.debian.org/936199
 Author: Andreas Tille <tille@debian.org>
 Last-Update: Sun, 01 Sep 2019 10:31:52 +0200
 
---- a/docs/conf.py
-+++ b/docs/conf.py
+Index: bedtools/docs/conf.py
+===================================================================
+--- bedtools.orig/docs/conf.py
++++ bedtools/docs/conf.py
 @@ -43,8 +43,8 @@ source_suffix = '.rst'
  master_doc = 'index'
  
  # General information about the project.
 -project = u'bedtools'
--copyright = u'2009 - 2017, Aaron R. Quinlan and Neil Kindlon'
+-copyright = u'2009 - 2019, Aaron R. Quinlan and Neil Kindlon'
 +project = 'bedtools'
-+copyright = '2009 - 2017, Aaron R. Quinlan and Neil Kindlon'
++copyright = '2009 - 2019, Aaron R. Quinlan and Neil Kindlon'
  
  # The version info for the project you're documenting, acts as replacement for
  # |version| and |release|, also used in various other places throughout the
@@ -36,8 +38,10 @@ Last-Update: Sun, 01 Sep 2019 10:31:52 +0200
  ]
  
  # Example configuration for intersphinx: refer to the Python standard library.
---- a/test/fisher/README.md
-+++ b/test/fisher/README.md
+Index: bedtools/test/fisher/README.md
+===================================================================
+--- bedtools.orig/test/fisher/README.md
++++ bedtools/test/fisher/README.md
 @@ -2,7 +2,7 @@ Fisher Testing
  ==============
  
@@ -47,8 +51,10 @@ Last-Update: Sun, 01 Sep 2019 10:31:52 +0200
  which will show the output from `bedtools fisher` and then running `bash shuf.sh`
  which will repeatedly run
  
---- a/test/fisher/cmp.sh
-+++ b/test/fisher/cmp.sh
+Index: bedtools/test/fisher/cmp.sh
+===================================================================
+--- bedtools.orig/test/fisher/cmp.sh
++++ bedtools/test/fisher/cmp.sh
 @@ -3,7 +3,7 @@ set -eo pipefail
  echo "fisher,shuffled"
  
@@ -58,8 +64,10 @@ Last-Update: Sun, 01 Sep 2019 10:31:52 +0200
      shuffle=$(bash shuf.sh)
      echo "$fisher,$shuffle"
  done
---- a/test/fisher/sim.py
-+++ b/test/fisher/sim.py
+Index: bedtools/test/fisher/sim.py
+===================================================================
+--- bedtools.orig/test/fisher/sim.py
++++ bedtools/test/fisher/sim.py
 @@ -25,7 +25,7 @@ with open('taa.bed', 'w') as fh:
          fh.write("chr1\t%i\t%i\n" % (s, e))
      fh.flush()
@@ -70,16 +78,20 @@ Last-Update: Sun, 01 Sep 2019 10:31:52 +0200
  # NOTE: add -m here to make merged output
 -print check_output("../../bin/bedtools fisher -a taa.bed -b tbb.bed -g tgg.genome", shell=True).strip()
 +print(check_output("../../bin/bedtools fisher -a taa.bed -b tbb.bed -g tgg.genome", shell=True).strip())
---- a/src/utils/BamTools/Makefile.frag
-+++ b/src/utils/BamTools/Makefile.frag
+Index: bedtools/src/utils/BamTools/Makefile.frag
+===================================================================
+--- bedtools.orig/src/utils/BamTools/Makefile.frag
++++ bedtools/src/utils/BamTools/Makefile.frag
 @@ -1,4 +1,4 @@
  src/utils/BamTools/include/BamAlignment.mapping.hpp: src/utils/BamTools/mapping/BamAlignment.py src/utils/BamTools/mapping/BamAlignment.map
  
  src/utils/BamTools/include/%.mapping.hpp: src/utils/BamTools/mapping/%.py src/utils/BamTools/mapping/%.map
 -	python $^ > $@
 +	python3 $^ > $@
---- a/test/bigchroms/test-bigchroms.sh
-+++ b/test/bigchroms/test-bigchroms.sh
+Index: bedtools/test/bigchroms/test-bigchroms.sh
+===================================================================
+--- bedtools.orig/test/bigchroms/test-bigchroms.sh
++++ bedtools/test/bigchroms/test-bigchroms.sh
 @@ -28,7 +28,7 @@ check obs abig.bed
  rm obs
  
@@ -89,9 +101,11 @@ Last-Update: Sun, 01 Sep 2019 10:31:52 +0200
  
  echo -e "    bigchroms.t03...big get fasta \c"
  $BT getfasta -fi bigx.fasta -bed bigx.bed | tail -1 > obs
---- a/Makefile
-+++ b/Makefile
-@@ -175,7 +175,7 @@ $(BIN_DIR)/bedtools: autoversion $(BUILT
+Index: bedtools/Makefile
+===================================================================
+--- bedtools.orig/Makefile
++++ bedtools/Makefile
+@@ -183,7 +183,7 @@ $(BIN_DIR)/bedtools.static: autoversion
  
  $(BIN_DIR)/intersectBed: | $(BIN_DIR)
  	@echo "- Creating executables for old CLI."

docs/conf.py

@@ -44,16 +44,16 @@ master_doc = 'index'
 
 # General information about the project.
 project = u'bedtools'
-copyright = u'2009 - 2017, Aaron R. Quinlan and Neil Kindlon'
+copyright = u'2009 - 2019, Aaron R. Quinlan and Neil Kindlon'
 
 # The version info for the project you're documenting, acts as replacement for
 # |version| and |release|, also used in various other places throughout the
 # built documents.
 #
 # The short X.Y version.
-version = '2.29.0'
+version = '2.29.1'
 # The full version, including alpha/beta/rc tags.
-release = '2.29.0'
+release = '2.29.1'
 
 # The language for content autogenerated by Sphinx. Refer to documentation
 # for a list of supported languages.

docs/content/history.rst

@@ -2,6 +2,18 @@
 Release History
 ###############
 
+Version 2.29.1 (9-Dec-2019)
+============================
+1. Fixed a `bug <https://github.com/arq5x/bedtools2/issues/773>`_ that now allows blocked intersection to be counted based on unique base pairs of overlap. The resolution for `issue 750 <https://github.com/arq5x/bedtools2/issues/750>`_ in version 2.29.0 mistakenly allowed for fractional overlap to be counted based upon redundant overlap. 
+2. Moved to Github Continuous Integration for automatic testing.
+3. Fixed a `bug <https://github.com/arq5x/bedtools2/issues/799>`_ that injected erroneous quality values with BAM records had no valid quality values.
+4. Fixed a `bug <https://github.com/arq5x/bedtools2/issues/609>`_ that destroyed backwards compatibility in the `getfasta` tool. Thanks to Torsten Seeman for reporting this.
+5. Fixed a corner case `bug <https://github.com/arq5x/bedtools2/issues/711>`_ in the `reldist` tool.
+6. Fixed a `bug <https://github.com/arq5x/bedtools2/issues/788>`_ in the `bedtobam` tool that caused the last character in read names to be removed.
+7. Fixed a `bug <https://github.com/arq5x/bedtools2/issues/779>`_ causing a segfault in the `jaccard` tool.
+8. Fixed a `bug <https://github.com/arq5x/bedtools2/issues/777>`_ causing a corner case issue in the way coordinates are reported in the `flank` tool.
+
+
 Version 2.29.0 (3-Sep-2019)
 ============================
 1. Added a new `-C` option to the `intersect` tool that separately reports the count of intersections observed for each database (`-b`) file given. Formerly, the `-c` option reported to sum of all intersections observed across all database files.

docs/content/installation.rst

@@ -42,8 +42,8 @@ The following commands will install ``bedtools`` in a local directory on an UNIX
 
 .. code-block:: bash
 
-  $ wget https://github.com/arq5x/bedtools2/releases/download/v2.28.0/bedtools-2.28.0.tar.gz 
-  $ tar -zxvf bedtools-2.28.0.tar.gz
+  $ wget https://github.com/arq5x/bedtools2/releases/download/v2.29.1/bedtools-2.29.1.tar.gz 
+  $ tar -zxvf bedtools-2.29.1.tar.gz
   $ cd bedtools2
   $ make
 

src/bamToFastq/bamToFastq.cpp

@@ -38,7 +38,7 @@ BamToFastq::~BamToFastq(void) {}
 void BamToFastq::SingleFastq() {
     // open the 1st fastq file for writing
     _fq = new ofstream(_fastq1.c_str(), ios::out);
-    if ( !*_fq1 ) {
+    if ( !*_fq ) {
         cerr << "Error: The first fastq file (" << _fastq1 << ") could not be opened.  Exiting!" << endl;
         exit (1);
     }

src/fastaFromBed/fastaFromBed.cpp

@@ -18,7 +18,8 @@ Bed2Fa::Bed2Fa(const string &dbFile,
                const string &bedFile, const string &fastaOutFile,
                bool useFasta, bool useStrand, 
                bool useBlocks, bool useFullHeader,
-               bool useBedOut, bool useName, bool useNamePlus) :
+               bool useBedOut, bool useName, 
+               bool useNamePlus, bool useNameOnly) :
     _dbFile(dbFile),
     _bedFile(bedFile),
     _fastaOutFile(fastaOutFile),
@@ -28,7 +29,8 @@ Bed2Fa::Bed2Fa(const string &dbFile,
     _useFullHeader(useFullHeader),
     _useBedOut(useBedOut),
     _useName(useName),
-    _useNamePlus(useNamePlus)
+    _useNamePlus(useNamePlus),
+    _useNameOnly(useNameOnly)
 {
     _bed = new BedFile(_bedFile);
 
@@ -74,15 +76,15 @@ void Bed2Fa::ReportDNA(const BED &bed, string &dna) {
     }
     else {
         ostringstream header;
-        if (_useName)
-        {
-            header << bed.name;
-        }
-        else if (_useNamePlus) 
+        if (_useName || _useNamePlus)
         {
             header << bed.name << "::" << bed.chrom << ":" 
                    << bed.start << "-" << bed.end;
         }
+        else if (_useNameOnly)
+        {
+            header << bed.name;
+        }
         else 
         {
             header << bed.chrom << ":" 
@@ -101,8 +103,6 @@ void Bed2Fa::ReportDNA(const BED &bed, string &dna) {
     }
 }
 
-
-
 //******************************************************************************
 // ExtractDNA
 //******************************************************************************

src/fastaFromBed/fastaFromBed.h

@@ -34,7 +34,8 @@ public:
            const string &bedFile, const string &fastaOutFile,
            bool useFasta, bool useStrand, 
            bool useBlocks, bool useFullHeader,
-           bool useBedOut, bool useName, bool useNamePlus);
+           bool useBedOut, bool useName, 
+           bool useNamePlus, bool useNameOnly);
 
     // destructor
     ~Bed2Fa(void);
@@ -56,6 +57,7 @@ private:
     bool _useBedOut;    // priginal BED records followed by FASTA on same line
     bool _useName;
     bool _useNamePlus;
+    bool _useNameOnly;
 
     // instance of a bed file class.
     BedFile  *_bed;

src/fastaFromBed/fastaFromBedMain.cpp

@@ -42,6 +42,7 @@ int fastafrombed_main(int argc, char* argv[]) {
     bool haveFastaOut = false;
     bool useName = false;
     bool useNamePlus = false;
+    bool useNameOnly = false;
     bool useFasta = true;
     bool useStrand = false;
     bool useBlocks = false;
@@ -94,6 +95,9 @@ int fastafrombed_main(int argc, char* argv[]) {
         else if(PARAMETER_CHECK("-name+", 6, parameterLength)) {
             useNamePlus = true;
         }
+        else if(PARAMETER_CHECK("-nameOnly", 9, parameterLength)) {
+            useNameOnly = true;
+        }
         else if(PARAMETER_CHECK("-split", 6, parameterLength)) {
             useBlocks = true;
         }
@@ -133,7 +137,7 @@ int fastafrombed_main(int argc, char* argv[]) {
                                  bedFile, fastaOutFile,
                                  useFasta, useStrand, 
                                  useBlocks, useFullHeader,
-                                 useBedOut, useName, useNamePlus);
+                                 useBedOut, useName, useNamePlus, useNameOnly);
         delete b2f;
     }
     else {
@@ -153,23 +157,24 @@ void fastafrombed_help(void) {
          << endl << endl;
 
     cerr << "Options: " << endl;
-    cerr << "\t-fi\tInput FASTA file" << endl;
-    cerr << "\t-fo\tOutput file (opt., default is STDOUT" << endl;
-    cerr << "\t-bed\tBED/GFF/VCF file of ranges to extract from -fi" << endl;
-    cerr << "\t-name\tUse the name field for the FASTA header" << endl;
-    cerr << "\t-name+\tUse the name field and coordinates for the FASTA header" << endl;
-    cerr << "\t-split\tgiven BED12 fmt., extract and concatenate the sequences"
-         << "\n\t\tfrom the BED \"blocks\" (e.g., exons)" << endl;
-    cerr << "\t-tab\tWrite output in TAB delimited format." << endl;
-    cerr << "\t\t- Default is FASTA format." << endl << endl;
-
-    cerr << "\t-s\tForce strandedness. If the feature occupies the antisense," 
+    cerr << "\t-fi\t\tInput FASTA file" << endl;
+    cerr << "\t-fo\t\tOutput file (opt., default is STDOUT" << endl;
+    cerr << "\t-bed\t\tBED/GFF/VCF file of ranges to extract from -fi" << endl;
+    cerr << "\t-name\t\tUse the name field and coordinates for the FASTA header" << endl;
+    cerr << "\t-name+\t\t(deprecated) Use the name field and coordinates for the FASTA header" << endl;
+    cerr << "\t-nameOnly\tUse the name field for the FASTA header" << endl;
+    cerr << "\t-split\t\tGiven BED12 fmt., extract and concatenate the sequences"
+         << "\n\t\t\tfrom the BED \"blocks\" (e.g., exons)" << endl;
+    cerr << "\t-tab\t\tWrite output in TAB delimited format." << endl;
+    cerr << "\t\t\t- Default is FASTA format." << endl;
+
+    cerr << "\t-s\t\tForce strandedness. If the feature occupies the antisense," 
          << endl;
-    cerr << "\t\tstrand, the sequence will be reverse complemented." << endl;
-    cerr << "\t\t- By default, strand information is ignored." << endl << endl;
+    cerr << "\t\t\tstrand, the sequence will be reverse complemented." << endl;
+    cerr << "\t\t\t- By default, strand information is ignored." << endl;
     cerr << "\t-fullHeader\tUse full fasta header." << endl;
-    cerr << "\t\t- By default, only the word before the first space or tab "
-	     << "\n\t\tis used." << endl << endl;
+    cerr << "\t\t\t- By default, only the word before the first space or tab "
+	     << "\n\t\t\tis used." << endl << endl;
 
     // end the program here
     exit(1);

src/flankBed/flankBed.cpp

@@ -84,36 +84,42 @@ void BedFlank::AddFlank(BED &bed, int leftFlank, int rightFlank) {
     // we'll create the flanks from these coordinates.
     BED left  = bed;
     BED right = bed;
+    // split of feature bed to be similar to BedFlank::AddStrandedFlank
+    BED feature = bed;
     
     left.zeroLength = false;
     right.zeroLength = false;
     
     // make the left flank (if necessary)
-    if ((leftFlank > 0) && (left.start != 0)) {
-        if ( (static_cast<int>(left.start) - leftFlank) > 0) 
+    // do not report a left flank if the left feature start is already
+    // the very first base of the scaffold
+    if ((leftFlank > 0) && (feature.start != 0)) {
+        if ( (static_cast<int>(feature.start) - leftFlank) > 0)
         {
-            left.end    = left.start;
+            left.end    = feature.start;
             left.start -= leftFlank;
         }
         else 
         {
-            left.end    = left.start;
+            left.end    = feature.start;
             left.start  = 0;
         }
         // report the left flank
         _bed->reportBedNewLine(left);
     }
     
-    // make the left flank (if necessary)
-    if (rightFlank > 0) {
-        if ( (static_cast<int>(right.end) + static_cast<int>(rightFlank+1))
+    // make the right flank (if necessary)
+    // Do not flank if the right flank of the feature (which is feature.end)
+    // is already last base of scaffold
+    if (rightFlank > 0 && (feature.end < chromSize) ) {
+        if ( (static_cast<int>(feature.end) + static_cast<int>(rightFlank+1))
              <= static_cast<int>(chromSize)) 
         {
-            right.start    = right.end;
+            right.start    = feature.end;
             right.end     += (rightFlank);
         }
         else {
-            right.start    = right.end;
+            right.start    = feature.end;
             right.end      = chromSize;
         }
         // report the right flank
@@ -131,20 +137,23 @@ void BedFlank::AddStrandedFlank(BED &bed, int leftFlank, int rightFlank) {
     }
 
     // init. our left and right flanks to the original BED entry.
-    // we'll create the flanks from these coordinates.
     BED left  = bed;
     BED right = bed;
-    
-    // make the left flank (if necessary)
-    if (rightFlank > 0) {
-        if ( (static_cast<int>(left.start) - rightFlank) > 0) 
+    // separate feature bed file because when calling both left and right flanks otherwise gives conflicts
+    BED feature = bed;
+    
+    // make the right flank (if necessary)
+    // Do not flank if the right flank of the feature (which is feature.start)
+    // since in reverse strand is first base of scaffold
+    if (rightFlank > 0 && (feature.start != 0)) {
+        if ( (static_cast<int>(feature.start) - rightFlank) > 0)
         {
-            left.end    = left.start;
+            left.end    = feature.start;
             left.start -= rightFlank;
         }
         else 
         {
-            left.end    = left.start;
+            left.end    = feature.start;
             left.start  = 0;
         }
         // report the left flank
@@ -152,14 +161,23 @@ void BedFlank::AddStrandedFlank(BED &bed, int leftFlank, int rightFlank) {
     }
     
     // make the left flank (if necessary)
-    if (leftFlank > 0) {
-        if ( (static_cast<int>(right.end) + leftFlank) <= static_cast<int>(chromSize)) 
+    // left.start is on the right side of the feature because feature is on reverse strand
+    // do not report a left flank if the feature.end is already last base of the scaffold
+    // coordinates here are BED so end is exclusive
+    // in BED coords, this will create a zero length feature with flank.start == flank.end
+    // however when converting however to GFF, the start will get +1
+    // and so the feature start will be 1 higher than the end
+    // resulting in errors in further bed tools
+    // you would create a left flank that has as left.start the feature.end coordinate
+    // so end needs to be smaller than chromsize to have at least 1 flanking base
+    if (leftFlank > 0 && (feature.end < chromSize) ) {
+        if ( (static_cast<int>(feature.end) + leftFlank) <= static_cast<int>(chromSize))
         {
-            right.start    = right.end;
+            right.start    = feature.end;
             right.end     += leftFlank;
         }
         else {
-            right.start    = right.end;
+            right.start    = feature.end;
             right.end      = chromSize;
         }
         // report the right flank

src/flankBed/test.fa

+>1
+ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT

src/flankBed/test.fa.fai

+1	100	3	100	101

src/flankBed/test.gff

+1	ena	gene	40	65	.	+	.	gene_id_1
+1	ena	gene	1	50	.	+	.	gene_id_2
+1	ena	gene	50	75	.	+	.	gene_id_3
+1	ena	gene	75	100	.	+	.	gene_id_4
+1	ena	gene	26	50	.	+	.	gene_id_5
+1	ena	gene	10	50	.	+	.	gene_id_6
+1	ena	gene	75	90	.	+	.	gene_id_7
+1	ena	gene	40	65	.	-	.	gene_id_8
+1	ena	gene	1	50	.	-	.	gene_id_9
+1	ena	gene	50	75	.	-	.	gene_id_10
+1	ena	gene	75	100	.	-	.	gene_id_11
+1	ena	gene	26	50	.	-	.	gene_id_12
+1	ena	gene	10	50	.	-	.	gene_id_13
+1	ena	gene	75	90	.	+	.	gene_id_14

src/genomeCoverageBed/genomeCoverageBed.cpp

@@ -50,7 +50,7 @@ BedGenomeCoverage::BedGenomeCoverage(string bedFile, string genomeFile,
 
 
     if (_bamInput == false) {
-        _genome = new GenomeFile(genomeFile);
+        _genome = new NewGenomeFile(genomeFile);
     }
 
     PrintTrackDefinitionLine();
@@ -101,14 +101,14 @@ void BedGenomeCoverage::StartNewChrom(const string& newChrom) {
         ReportChromCoverage(_currChromCoverage, _currChromSize,
                 _currChromName, _currChromDepthHist);
     }
-
     // empty the previous chromosome and reserve new
     std::vector<DEPTH>().swap(_currChromCoverage);
 
     if (_visitedChromosomes.find(newChrom) != _visitedChromosomes.end()) {
-        cerr << "Input error: Chromosome " << _currChromName
-             << " found in non-sequential lines. This suggests that the input file is not sorted correctly." << endl;
-
+        cerr << "Input error: Chromosome "
+             << _currChromName
+             << " found in non-sequential lines. This suggests that the input file is not sorted correctly." 
+             << endl;
     }
     _visitedChromosomes.insert(newChrom);
 
@@ -120,7 +120,10 @@ void BedGenomeCoverage::StartNewChrom(const string& newChrom) {
     if (_currChromSize >= 0)
         _currChromCoverage.resize(_currChromSize);
     else {
-        cerr << "Input error: Chromosome " << _currChromName << " found in your input file but not in your genome file." << endl;
+        cerr << "Input error: Chromosome " 
+             << _currChromName 
+             << " found in your input file but not in your genome file." 
+             << endl;
         exit(1);
     }
 }
@@ -161,11 +164,17 @@ void BedGenomeCoverage::CoverageBed() {
         if (_bed->_status == BED_VALID) {
             if (_filterByStrand == true) {
                 if (a.strand.empty()) {
-                    cerr << "Input error: Interval is missing a strand value on line " << _bed->_lineNum << "." <<endl;
+                    cerr << "Input error: Interval is missing a strand value on line " 
+                         << _bed->_lineNum 
+                         << "." <<endl;
                     exit(1);
                 }
                 if ( ! (a.strand == "-" || a.strand == "+") ) {
-                    cerr << "Input error: Invalid strand value (" << a.strand << ") on line " << _bed->_lineNum << "." << endl;
+                    cerr << "Input error: Invalid strand value (" 
+                         << a.strand << ") on line " 
+                         << _bed->_lineNum 
+                         << "." 
+                         << endl;
                     exit(1);
                 }
                 // skip if the strand is not what the user requested.
@@ -190,10 +199,11 @@ void BedGenomeCoverage::CoverageBed() {
                 CHRPOS pos = ( a.strand=="-" ) ? a.start : a.end-1;
                 AddCoverage(pos,pos);
             }
-            else
+            else {
                 AddCoverage(a.start, a.end-1);
             }
         }
+    }
     _bed->Close();
 
     // process the results of the last chromosome.
@@ -247,7 +257,9 @@ void BedGenomeCoverage::CoverageBam(string bamFile) {
     // open the BAM file
     BamReader reader;
     if (!reader.Open(bamFile)) {
-        cerr << "Failed to open BAM file " << bamFile << endl;
+        cerr << "Failed to open BAM file " 
+             << bamFile 
+             << endl;
         exit(1);
     }
 
@@ -256,7 +268,7 @@ void BedGenomeCoverage::CoverageBam(string bamFile) {
     RefVector refs = reader.GetReferenceData();
 
     // load the BAM header references into a BEDTools "genome file"
-    _genome = new GenomeFile(refs);
+    _genome = new NewGenomeFile(refs);
     // convert each aligned BAM entry to BED
     // and compute coverage on B
     BamAlignment bam;
@@ -480,7 +492,14 @@ void BedGenomeCoverage::ReportChromCoverageBedGraph(const vector<DEPTH> &chromCo
                 if (lastDepth >= _max) {
                     lastDepth = _max;
                 }
-                cout << chrom << "\t" << lastStart << "\t" << pos << "\t" << lastDepth * _scale << endl;
+                cout << chrom 
+                     << "\t" 
+                     << lastStart 
+                     << "\t" 
+                     << pos 
+                     << "\t" 
+                     << lastDepth * _scale 
+                     << endl;
             }
             //Set current position as the new interval start + depth
             lastDepth = depth;
@@ -493,6 +512,13 @@ void BedGenomeCoverage::ReportChromCoverageBedGraph(const vector<DEPTH> &chromCo
     }
     //Print information about the last position
     if ( (lastDepth != -1) && (lastDepth > 0 || _bedGraphAll) ) {
-        cout << chrom << "\t" << lastStart << "\t" << chromSize << "\t" << lastDepth * _scale << endl;
+        cout << chrom 
+             << "\t" 
+             << lastStart 
+             << "\t" 
+             << chromSize 
+             << "\t" 
+             << lastDepth * _scale 
+             << endl;
     }
 }

src/genomeCoverageBed/genomeCoverageBed.h

@@ -10,7 +10,7 @@ aaronquinlan@gmail.com
 Licenced under the GNU General Public License 2.0 license.
 ******************************************************************************/
 #include "bedFile.h"
-#include "GenomeFile.h"
+#include "NewGenomeFile.h"
 
 #include "BlockedIntervals.h"
 #include "api/BamReader.h"
@@ -81,7 +81,7 @@ private:
     string _requestedStrand;
 
     BedFile *_bed;
-    GenomeFile *_genome;
+    NewGenomeFile *_genome;
 
     // data for internal processing
     chromDepthMap _chromCov;

src/reldist/reldist.cpp

@@ -141,7 +141,14 @@ void RelativeDistance::CalculateRelativeDistance()
                 // and the two nearest database midpoints.
                 CHRPOS left_dist = abs(midpoint-left);
                 CHRPOS right_dist = abs(midpoint-right); 
+                if (min(left_dist, right_dist) == 0)
+                {
+                    rel_dist = 0.0;
+                }
+                else
+                {
                     rel_dist = (double) min(left_dist, right_dist) / (double) (right-left);
+                }
                 if (!_summary)
                 {
                     _bedA->reportBedTab(bed);

src/slopBed/slopBed.cpp

@@ -67,88 +67,32 @@ void BedSlop::SlopBed() {
    }
    _bed->Close();
 }
-
-
+static inline long _normalize_coord(long size, long pos) {
+	if(pos < 0) return 0;
+	if(size >= 0 && pos > size) return size;
+	return pos;
+}
 void BedSlop::AddSlop(BED &bed) {
 
     // special handling if the BED entry is on the negative
     // strand and the user cares about strandedness.
     CHRPOS chromSize = (CHRPOS)_genome->getChromSize(bed.chrom);
 
-    if ( (_forceStrand) && (bed.strand == "-") ) {
-        if ( ((int)bed.start - (long)_rightSlop) >= 0 ) {
-          // if the _rightSlop is negative and pushes bed.start to be > chromSize 0, set to chromSize
-            if (((int)bed.start - (long)_rightSlop) >= chromSize && _rightSlop < 0) {
-                bed.start = chromSize;  
-            }
-            else {
-                bed.start = bed.start - (long)_rightSlop;
-            }
-            // checking if start is already outside of chrom bounds.
-            // issue #195
-            if((bed.start >= chromSize) || ((bed.start + (CHRPOS)_leftSlop) >= chromSize))
-            {
-                bed.start = chromSize;
+	if(chromSize < 0) {
+		cerr << "* Input error: Chromosome " << bed.chrom << " doesn't present in the .genome file. *" << endl;
+		exit(1);
 	}
-        }
-        else {
-            bed.start = 0;
-        }
-        if ( ((int)bed.end + (long)_leftSlop) <= chromSize ) {
-            // if the _leftSlop is negative and pushes bed.end to be < 0, set to 0
-            if((((int)bed.end + (int)_leftSlop) <= 0) && _leftSlop < 0) {
-                bed.end = 0;
-            }
-            else {
-                bed.end = bed.end + (int)_leftSlop;
-            }
-        }    
-        else {
 
-            bed.end = chromSize;
-        }
-    }
-    // strand is +
-    else 
-    {
-        if ( (bed.start - (CHRPOS)_leftSlop) >= 0 ) {
-            // checking negative condition for _leftSlop
-            if( (bed.start - (CHRPOS)_leftSlop) >= chromSize && _leftSlop < 0)
-            {
-              bed.start = chromSize;
-            }
-            else {
-              bed.start = bed.start - (CHRPOS)_leftSlop;
-            }
-            // checking if start is already outside of chrom bounds.
-            // issue #195
-            if((bed.start >= chromSize) || ((bed.start + (CHRPOS)_leftSlop) >= chromSize))
-            {
-                bed.start = chromSize;
-            }
-        }
-        else 
-        {
-            bed.start = 0;
-        }
+	bool should_swap = _forceStrand && bed.strand == "-";
+	long left_slop = should_swap ? (long)_rightSlop : (long)_leftSlop;
+	long right_slop = should_swap ? (long)_leftSlop : (long)_rightSlop;
+
+	bed.start -= left_slop;
+	bed.end += right_slop;
+
+	bed.start = _normalize_coord(chromSize, bed.start);
+	bed.end = _normalize_coord(chromSize, bed.end);
 
-        if ( (bed.end + (CHRPOS)_rightSlop) <= chromSize )
-        {
-            // checking negative _rightSlop condition
-            if( (bed.end + (CHRPOS)_rightSlop) <= 0 && _rightSlop < 0) 
-            {
-                bed.end = 0;
-            }
-            else 
-            {
-                bed.end = bed.end + (CHRPOS)_rightSlop;            
-            }
-        }
-        else
-        {
-            bed.end = chromSize; 
-        }
-    }
     //checking edge case and adjusting
     if( bed.start == bed.end && bed.start == chromSize ){
       bed.start -= 1;