Skip to content
Commits on Source (10)
Expand all Show whitespace changes
Inline Side-by-side
Build.PL
View file @ 0a45cebf
#!/usr/bin/perl -w
#!/usr/bin/perl
# This is a Module::Build script for BioPerl-Run installation.
# See http://search.cpan.org/~kwilliams/Module-Build/lib/Module/Build.pm
......@@ -32,7 +32,7 @@ my $build = Module::Build->subclass(
)
)->new(
dist_name => 'BioPerl-Run',
dist_version => '1.007002',
dist_version => '1.007003',
module_name => 'Bio::Run',
dist_author => 'BioPerl Team <bioperl-l@bioperl.org>',
dist_abstract => 'BioPerl-Run - wrapper toolkit',
......@@ -50,13 +50,14 @@ my $build = Module::Build->subclass(
'Bio::Root::Root' => 0,
},
recommends => {
'Bio::Cluster::SequenceFamily' => 0, # Bio::Tools::Run::TribeMCL
'Algorithm::Diff' => 0, # generating consensus protein family descriptions: Bio::Tools::Run::TribeMCL
'IPC::Run' => 0, # Glimmer and Genemark application wrappers: Bio::Tools::Run::Glimmer Bio::Tools::Run::Genemark
'IO::String' => 0, # generating Bio::Tree::Tree from strings: Bio::Tools::Run::Phylo::Phylip::Consense
'XML::Twig' => 0, # processing XML data: Bio::Tools::Run::EMBOSSacd
'File::Sort' => 0, # BEDTools
'Config::Any' => 0, # MCS, Match
'Bio::FeatureIO' => 0, # MCS, Match, Phastcons, Gumby
'Bio::FeatureIO' => 0, # MCS, Match, Phastcons
#'SOAP::Lite' => 0.716, # A bug that affects SoapEU-unit.t tests was fixed in this version (many levels deep object throws error)
},
get_options => {
......@@ -119,4 +120,3 @@ else {
# Create the build script and exit
$build->create_build_script;
Changes
View file @ 0a45cebf
Revision history for bioperl-run modules
Summary of important user-visible changes for BioPerl-Run
---------------------------------------------------------
1.7.3
* The following modules have been moved to the BioPerl
distribution so that new BioPerl Run tools can be developed
without being dependent on the whole BioPerl-Run distribution:
Bio::Tools::Run::Analysis
Bio::Tools::Run::AnalysisFactory
Bio::Tools::Run::Phylo::PhyloBase
Bio::Tools::Run::WrapperBase
Bio::Tools::Run::WrapperBase::CommandExts
* The following modules have been removed from BioPerl-Run to be
part of separate distributions and have independent development:
Bio::Tools::Phylo::Gumby
Bio::Tools::Run::AssemblerBase
Bio::Tools::Run::BWA
Bio::Tools::Run::BWA::Config
Bio::Tools::Run::Bowtie
Bio::Tools::Run::Bowtie::Config
Bio::Tools::Run::Cap3
Bio::Tools::Run::Maq
Bio::Tools::Run::Maq::Config
Bio::Tools::Run::Meme
Bio::Tools::Run::Minimo
Bio::Tools::Run::Newbler
Bio::Tools::Run::Phrap
Bio::Tools::Run::Phylo::Gumby
Bio::Tools::Run::TigrAssembler
* New program previously part of the BioPerl distribution:
bp_blast2tree
* All Bio::Installer modules and the bioperl_application_installer
script have been removed. These were unsafe and out of date.
Use a package manager of your choice to install external
programs.
1.7.2
......
debian/changelog
View file @ 0a45cebf
bioperl-run (1.7.3-1) unstable; urgency=medium
* New upstream version
* debhelper 12
* Standards-Version: 4.3.0
* Drop dependencies: bowtie, bwa, maq, t-coffee, gmap, paml
Thanks for the hint to Carnë Draug <carandraug+dev@gmail.com>)
* Versioned (Build-)Depends: bioperl (>= 1.7.4)
-- Andreas Tille <tille@debian.org> Mon, 11 Feb 2019 22:14:53 +0100
bioperl-run (1.7.2-4) unstable; urgency=medium
* (Build-)Depends: ncoils
......
debian/control
View file @ 0a45cebf
......@@ -5,10 +5,10 @@ Uploaders: Charles Plessy <plessy@debian.org>,
Section: science
Testsuite: autopkgtest-pkg-perl
Priority: optional
Build-Depends: debhelper (>= 11~)
Build-Depends: debhelper (>= 12~)
Build-Depends-Indep: perl,
libmodule-build-perl,
bioperl,
bioperl (>= 1.7.4),
# Recommended in Build.PL:
libalgorithm-diff-perl,
libipc-run-perl,
......@@ -23,8 +23,6 @@ Build-Depends-Indep: perl,
amap-align,
bedtools,
blast2,
bowtie,
bwa,
clustalw,
emboss,
exonerate,
......@@ -32,7 +30,6 @@ Build-Depends-Indep: perl,
hyphy-mpi,
infernal,
kalign,
maq,
mafft,
muscle,
ncoils,
......@@ -43,12 +40,11 @@ Build-Depends-Indep: perl,
raxml,
samtools,
sim4,
t-coffee,
tigr-glimmer,
wise,
# Needed for the network tests:
libwww-perl
Standards-Version: 4.2.1
Standards-Version: 4.3.0
Vcs-Browser: https://salsa.debian.org/med-team/bioperl-run
Vcs-Git: https://salsa.debian.org/med-team/bioperl-run.git
Homepage: https://metacpan.org/release/BioPerl-Run
......@@ -57,7 +53,7 @@ Package: bioperl-run
Architecture: all
Depends: ${misc:Depends},
${perl:Depends},
bioperl,
bioperl (>= 1.7.4),
libbio-perl-run-perl (= ${source:Version})
Recommends: amap-align,
bedtools,
......@@ -87,8 +83,7 @@ Recommends: amap-align,
tigr-glimmer,
wise
# Non-Free.
Suggests: gmap,
paml
Suggests: gmap
# Removed from Debian at all molphy,
# Removed from Debian but might be reintroduced ensembl,
# The following list of packages is not available in Debian:
......
debian/patches/fix_bowtie_call.patch deleted 100644 → 0
View file @ cf6bb849
Author: Andreas Tille <tille@debian.org>
Last-Update: Sat, 14 Jan 2017 19:13:53 +0100
Bug-Debian: https://bugs.debian.org/868073
Bug-Vendor: https://github.com/bioperl/bioperl-run/issues/52
Description: Do not try to run bowtie tests with wrong bowtie call
The testsuite (somehow magically) translates to bowtie-align but the
executables are either bowtie-align-l or bowtie-align-s
--- a/t/Bowtie.t
+++ b/t/Bowtie.t
@@ -30,7 +30,7 @@ BEGIN {
my $DEBUG = test_debug();
print STDERR $ulimit if $DEBUG == 1;
- test_begin(-tests => 70,
+ test_begin(-tests => 61,
-requires_modules => [qw(IPC::Run Bio::Tools::Run::Bowtie)]);
}
@@ -231,12 +231,15 @@ SKIP : {
), "make a crossbow alignment factory";
is( $bowtiefac->command, 'crossbow', "command attribute set");
- ok $sam = $bowtiefac->run($rdc, $refseq), "make file based alignment";
- ok eval { (-e $sam)&&(-r _) }, "make readable output";
- open (FILE, $sam);
- $lines =()= <FILE>;
- close FILE;
- is( $lines, 6, "number of alignments"); # 3 alignments and 3 SAM header lines
+## No idea how from this call a command line
+## bowtie-align --wrapper basic-0 -e 70 -l 28 -n 2 -S --12 t/data/bowtie/reads/e_coli.cb t/data/bowtie/indexes/e_coli /tmp/ILc9j2LRpw/aBsCFOfFVE.sam
+## is constructed but in any case this line is wrong since it needs to be either bowtie-align-s or bowtie-align-l
+# ok $sam = $bowtiefac->run($rdc, $refseq), "make file based alignment";
+# ok eval { (-e $sam)&&(-r _) }, "make readable output";
+# open (FILE, $sam);
+# $lines =()= <FILE>;
+# close FILE;
+# is( $lines, 6, "number of alignments"); # 3 alignments and 3 SAM header lines
ok $bowtiefac = Bio::Tools::Run::Bowtie->new(
-command => 'single',
@@ -247,18 +250,21 @@ SKIP : {
ok $bowtiefac->set_parameters( -inline => 1 );
- ok $bowtiefac->_run( -ind => $refseq,
- -seq => $inlstr ), "read sequence as strings in memory";
-
- like($bowtiefac->stderr, qr/reads processed: 1000/, "bowtie success");
-
- ok $bowtiefac->run( \@inlstr, $refseq ), "read sequence as seq objects";
-
- like($bowtiefac->stderr, qr/reads processed: 1000/, "bowtie success");
-
- ok $bowtiefac->run( \@inlobj, $refseq ), "read sequence as seq objects";
-
- like($bowtiefac->stderr, qr/reads processed: 1000/, "bowtie success");
+## No idea how from this call a command line
+## bowtie-align --wrapper basic-0 -l 28 -e 70 -n 2 -S -c t/data/bowtie/indexes/e_coli 'GAACGATACCCACCCAACTATCGCCATTCCAGCAT,CCGAACTGGATGTCTCATGGGATAAAAATCATCCG,TCAAAATTGTTATAGTATAACACTGTTGCTTTATG,AAAATTTGTGCCTGGATGGCCTGAGTACCNANTAC,GCAGAGCAGTTGCTAGAAANNNNNTTGAAGAGGTT,CAGCATAAGTGGATATTCAAAGTTTTGCTGTTTTA,GGCAGTGATGCAACTGCCCGTTATCAACAGNCNCT,GCATATTGCCAATTTTCGCTTCGGGGATCAGGCTA,GGTTCAGTTCAGTATACGCCTTATCCGGCCTACGG,GGCGATGATTTCATTACCCTCAACGCCGAACAGGC,AATCCCACGGCGGCAGCATGGTCCTAGANAGGNCG,TTACCACCGAAGTAGCTTACCCATGCGCCGCCGAC,AATCACAGGCGGTGAGCAGTAACGATAATTCGGCT,CAGCTCGCACGCCACGCCGAACCATGTCATCAATT,CGCTTTTGTCCTCGGCGACTTCGGCAACCGATGCG,GGGTCTGGCCGTTTTCTGCTTCAACTTCAACAATC,ATCCGGTTAAAGATGTTGAGAAATATGTGGTGATG,TTTTGTGTGTGTAGTAGGCCTTGGATATTGGGGCT,CCTGAAGGCGCGCGTGACTACCTGGTGCCTTCTCG,CATATGCCCCAGCACTCTGATGGCATCGCCTTCCA,ATAGACGCAAAAGAGCAAATAACATTTCTTCACAA,TAATGATAAGGAATCACTGTTTTTGAGAAAAGATA,TTGGGATTGTGGGCGTGACAATTTTCTCGATGATT,ATCGCGAACACCTTTACCGATTTATCGCCGAAGTG,AGATGAAGTTGTTTTGGCGTCATTCCGAAAAATTG,TCCGTATTCAGGGCGCTGCGGGAGAAGAAATCNGT,ATGGGAACAGTAATCTTTTTTACTGGTTCTGCGTC,TATGTCACATTTATTTTTCCTTAAAACTACAATAT,TGTTTTCCCGGTTGTCGGGGATCGGTTTGCCGCTG,ACCTGGAAATCTGTACCAAACCCCATGCCGGATAA,AGCAACATCATTCTCCCGTAAAAAGGGAGTCGATG,CCGATAGTGCCGTAGTANAATTAGTTTTTNNTTAG,TCGTTTCTGTCTGAGTCGATAGCTTTCTCCTTTGA,CGTGGTCATCAGATCATGCGGCAAACCAAANNNNN,AGCGGCCAGGTGCTTTCCGGGATAGTAAACAGGCG,GCAACGCGCGGGGCTAATCGGGATCTGCCCGGAAG,CCGGTTTCACATCCGGTGCAGGCTGTGGTGCTGAC,GCATTGCTGCCCATCCTGATTTGCCTGTTAAGCAG,GCCGTCTGCACCGTAGCCTGGTATGTGAGTGCGAA,GCTATCTGCCGTTCAGTCAGAGTNCGANGCCTNAN,CGCAGTCGAAGAGGTGGAAGCATTAATGCNTAATA,CGAATCAGGCGATTCGTCAGACGGGAATGTTGNGT,TCCACGGAAGTTTTCAGAGATGAGAATGTGCCTTC,TTGCAGGAAATTCTGTNACCCTCNACNAAGCATCA,AGAAAATATGACCCCGCAGGATTACAACGACGTCN,GAAAAAGTTTCATAAAGACTCCAGATGATCGATGG,TTTCGGGGATGCGGTGGCGCGTCTGGATAAGCGTC,ATCCGGATTGTATTGAGATCCTGCCCGTGNGCTCA,CCAACCTTCTCCGCCTGCTTCGGCGCGGCGTTCCT,TGTTTCGCGTCGCAAAGTGGAGCGAGACGTGCAAG,GTGGTGCATTTTGATATTCCGCGCAATATCGAATC,GTCGTTATAGTCTTCAAGCCACGGGTAGACGAAAG,GCGTTTATGCGCGTGAACANNANTCCTCATATTAA,GCTGCGGGATCACCTGATCTGCCGGATGTCGTGTA,ATCGTTCATTGAGCGCAAAATGACGCTTTTGAGGG,AATGACTATCCGCTGGATCACGAATTTATCAGTGT,AAGGCAACGAAGAAGCCGATGATCCAGATCCAGCA,TGGGTGTAAGCCTGTTCCACTGCCTGCTGTTANCT,ACGCGTTTACTGTTCACCAGATCGCCCATCAACAT,TGATGTAACGCCTGATGGCCTGCATATCGCCCAGT,ACGGGTCAGCAACATCTGCCCGATATGAATGTNGN,CGATGAAGAAAAATCGCTGGTGAAACAAGCAGATG,GTCGCTCGCTACGATCAGCAAAAATATGACATCTT,CATTTCTGTACTCATGCAGCCCCCTTCTGAAATAA,CACGCGTTGGGTATGGACGAACTGGAAGGTCATGA,TGAGAACGGCTTATCTCATTTTCGCAGTCACTATT,GTCCGGCATCCAGGTTTTTCACGGCAGATTATCAG,GACATGTGAACCTTCTTTTTCAAGCTGCCAATGAT,TGCTATTTATCGAACTGGGGGGGGAGAACCTGCNC,ACCCCCTCATACCCACCTCTTTCTCCANGTNNGTN,TAATTCGATGCAACGCGAAGAACCTTACCTGGACT,TNNNNNNNNNNNNNNNNNNNNNNNNNGNNNNNNNN,GTTCACGGGGTTAGCGAAGATCCATCCCGCGTGCA,CCAATGANNNNNNNNNNNNNNNNNNNNNNNNNNNN,AGTTGAAACATTTTACCTGCATCAGCACACGGTNG,ACGTTCAGTTCTTTCGCCAGTGCTTTCAGCTAACG,TTTGCAGTAAAGGGTAAACGGATTGCCAGACNCCA,ATAGCCGCCCGC
+## is constructed but in any case this line is wrong since it needs to be either bowtie-align-s or bowtie-align-l
+# ok $bowtiefac->_run( -ind => $refseq,
+# -seq => $inlstr ), "read sequence as strings in memory";
+#
+# like($bowtiefac->stderr, qr/reads processed: 1000/, "bowtie success");
+#
+# ok $bowtiefac->run( \@inlstr, $refseq ), "read sequence as seq objects";
+#
+# like($bowtiefac->stderr, qr/reads processed: 1000/, "bowtie success");
+#
+# ok $bowtiefac->run( \@inlobj, $refseq ), "read sequence as seq objects";
+#
+# like($bowtiefac->stderr, qr/reads processed: 1000/, "bowtie success");
$bowtiefac->set_parameters( -inline => 0 );
ok $sam = $bowtiefac->run($rdr,$refseq), "make variable based alignment";
debian/patches/series
View file @ 0a45cebf
skip_tests_for_wise.patch
skip_tests_for_phylip.patch
skip_tests_for_phyml.patch
skip_tests_for_bowtie.patch
skip_tests_for_infernal.patch
skip_tests_for_muscle.patch
skip_tests_for_ncbi-blast+.patch
skip_tests_for_maq.patch
hyphy.patch
remove_tests_for_ensembl.patch
fix_bowtie_call.patch
skip_tests_for_soap.patch
debian/patches/skip_tests_for_bowtie.patch deleted 100644 → 0
View file @ cf6bb849
Author: Andreas Tille <tille@debian.org>
Last-Update: Fri, 16 Dec 2016 09:17:37 +0100
Description: Exclude three failed tests of bowtie
--- a/t/Bowtie.t
+++ b/t/Bowtie.t
@@ -30,7 +30,7 @@ BEGIN {
my $DEBUG = test_debug();
print STDERR $ulimit if $DEBUG == 1;
- test_begin(-tests => 73,
+ test_begin(-tests => 70,
-requires_modules => [qw(IPC::Run Bio::Tools::Run::Bowtie)]);
}
@@ -219,9 +219,6 @@ SKIP : {
close FILE;
is( $lines, 1003, "number of alignments");
is($bowtiefac->want( 'Bio::Assembly::Scaffold' ), 'Bio::Assembly::Scaffold', "change mode");
- ok my $assy = $bowtiefac->run($rdq, $refseq), "make alignment";
- is( $assy->get_nof_contigs, 4, "number of contigs");
- is( $assy->get_nof_singlets, 691, "number of singlets");
# tests from here may fail due to insufficient memory - works with >=2GB
# test crossbow
debian/patches/skip_tests_for_maq.patch deleted 100644 → 0
View file @ cf6bb849
Author: Andreas Tille <tille@debian.org>
Last-Update: Fri, 16 Dec 2016 09:17:37 +0100
Description: Hmmmm, seems one contig less is detected - no idea why
--- a/t/Maq.t
+++ b/t/Maq.t
@@ -185,7 +185,7 @@ SKIP : {
is( $maqfac->c2q_min_map_quality, 40, "c2q param set");
ok my $assy = $maqfac->run($rd1,$refseq,$rd2), "make full assy";
#some fuzziness in these: sometimes maq gives 41+4, sometimes 42+6.
- cmp_ok( $assy->get_nof_contigs, '>=', 37, "number of contigs");
+ cmp_ok( $assy->get_nof_contigs, '>=', 36, "number of contigs");
cmp_ok( $assy->get_nof_singlets,'>=',4, "number of singlets");
}
debian/patches/skip_tests_for_ncbi-blast+.patch
View file @ 0a45cebf
......@@ -8,12 +8,12 @@ Description: Somehow tests are excluded automatically - adjust expected number o
our $home;
BEGIN {
use Bio::Root::Test;
- test_begin(-tests => 73);
+ test_begin(-tests => 71);
# -requires_modules => [qw( Bio::Tools::Run::BlastPlus)]);
}
@@ -42,8 +42,8 @@ SKIP : {
- test_begin(-tests => 73,
+ test_begin(-tests => 71,
-requires_module => "IPC::Run");
use_ok( 'Bio::Tools::Run::StandAloneBlastPlus' );
use_ok( 'Bio::Tools::Run::WrapperBase' );
@@ -43,8 +43,8 @@ SKIP : {
-create => 1
);
......
debian/patches/skip_tests_for_soap.patch 0 → 100644
View file @ 0a45cebf
Author: Andreas Tille <tille@debian.org>
Last-Update: Mon, 11 Feb 2019 19:34:04 +0100
Description: Somehow these tests are failing - no idea why
--- a/t/AnalysisFactory_soap.t
+++ /dev/null
@@ -1,56 +0,0 @@
-# -*-Perl-*-
-# $id$
-## Bioperl Test Harness Script for Modules
-
-use strict;
-
-BEGIN {
- use Bio::Root::Test;
-
- # The EMBL-EBI Soaplab server has been decommissioned on 1st February 2013
- # (https://www.ebi.ac.uk/Tools/webservices/about/news).
- # Website "http://www.ebi.ac.uk/soaplab/services" dont exists anymore,
- # so tests will fail with "404 Not Found" if executed
- test_begin(-tests => 0,
- -requires_networking => 1);
- use_ok('Bio::Tools::Run::AnalysisFactory');
-}
-
-
-# setup global objects that are to be used in more than one test
-# Also test they were initialised correctly
-# test new with default access
-my $factory = Bio::Tools::Run::AnalysisFactory->new();
-isa_ok( $factory, 'Bio::Tools::Run::AnalysisFactory');
-
-# test new with explicit access
-$factory = Bio::Tools::Run::AnalysisFactory->new(-access=>'soap');
-isa_ok( $factory, 'Bio::Tools::Run::AnalysisFactory');
-
-# test new with non-existing access
-throws_ok { Bio::Tools::Run::AnalysisFactory->new(-access=>'non_existing') } qr/cannot be found or loaded/, 'Non existant access method threw an error';
-
-# test default factory values
-
-# Now onto the nitty gritty tests of the modules methods
-SKIP: {
- test_skip(-tests => 9, -requires_module => 'SOAP::Lite');
- use_ok('SOAP::Lite');
-
- my $array_ref = $factory->available_categories;
- isa_ok( $array_ref, 'ARRAY' );
- ok( grep(/protein/i, @$array_ref), 'available_categories returned category with protein' );
-
- $array_ref = $factory->available_analyses;
- isa_ok( $array_ref, 'ARRAY' );
- ok( grep(/seqret/i, @$array_ref), 'available_analyses returned category with seqret' );
-
- $array_ref = $factory->available_analyses('edit');
- isa_ok( $array_ref, 'ARRAY' );
- ok( grep(/seqret/i, @$array_ref), 'available_analyses("edit") returned something' );
-
- my $service;
- lives_ok {$service = $factory->create_analysis('edit.seqret')};
- skip ("create_analysis failed :$@", 1) if $@;
- isa_ok( $service, 'Bio::Tools::Run::Analysis::soap' );
-}
--- a/t/Analysis_soap.t
+++ /dev/null
@@ -1,72 +0,0 @@
-# -*-Perl-*-
-# $id$
-## Bioperl Test Harness Script for Modules
-
-use strict;
-
-BEGIN {
- use Bio::Root::Test;
-
- # The EMBL-EBI Soaplab server has been decommissioned on 1st February 2013
- # (https://www.ebi.ac.uk/Tools/webservices/about/news).
- # Website "http://www.ebi.ac.uk/soaplab/services" dont exists anymore,
- # so tests will fail with "404 Not Found" if executed
- test_begin(-tests => 0,
- -requires_networking => 1);
- use_ok('Bio::Tools::Run::Analysis');
- use_ok('File::Spec');
-}
-
-SKIP: {
- test_skip(-tests => 15, -requires_module => 'SOAP::Lite');
- use_ok('SOAP::Lite');
-
- my $seqret = Bio::Tools::Run::Analysis->new(-name=>'edit.seqret');
- my $seq = 'tatacga';
-
- SKIP: {
- # condition used to skip this block of tests
- #skip($why, $how_many_in_block);
- skip("Failed to create the analysis object", 1)
- unless isa_ok( $seqret, 'Bio::Tools::Run::Analysis::soap');
-
- # test seqret service with some testing data
- # TODO: use BIOPERLDEBUG to skip these tests
- my %input = (
- 'sequence_direct_data' => $seq,
- 'osformat' => 'raw',
- );
- is( $seqret->analysis_name, 'seqret', 'analysis_name returned seqret' );
- isa_ok( $seqret->analysis_spec, 'HASH');
-
- my $input_spec = $seqret->input_spec;
- isa_ok( $input_spec, 'ARRAY' );
- ok( @$input_spec > 0, 'input_spec returned an array with something in it' );
- isa_ok( $input_spec->[0], 'HASH' );
- my $result_spec = $seqret->result_spec;
- isa_ok( $result_spec, 'ARRAY' );
- ok( @$result_spec > 0, 'result_spec returned an array with something in it' );
- like( $seqret->describe, '/^<\?xml /', 'describe seems to have returned the correct thing' );
- my $job = $seqret->create_job (\%input);
- SKIP: {
- skip("Object not created correctly", 6) unless isa_ok( $job, 'Bio::Tools::Run::Analysis::Job' );
-
- is( $job->status, 'CREATED', 'Job status correct' );
- # TODO: not goot to use private methods
- my $cloned_job = $seqret->create_job ($job->{'_id'});
-
- SKIP: {
- skip( "Couldn't clone the job", 2 )
- unless isa_ok( $cloned_job, 'Bio::Tools::Run::Analysis::Job',
- 'Job cloned successfully' );
-
- like( $cloned_job->last_event, '/^<\?xml /',
- 'last_event seems to have returned the correct thing' );
- $cloned_job->remove;
- # TODO: not good to use private methods
- is( $cloned_job->{'_destroy_on_exit'}, 1,
- 'Cloned job removed successfully' );
- }
- }
- }
-}
lib/Bio/Installer/EMBOSS.pm deleted 100644 → 0
View file @ cf6bb849
# BioPerl module for Bio::Installer::EMBOSS
#
# Please direct questions and support issues to <bioperl-l@bioperl.org>
#
# Cared for by Albert Vilella
#
# Copyright Albert Vilella
#
# You may distribute this module under the same terms as perl itself
# POD documentation - main docs before the code
=head1 NAME
Bio::Installer::EMBOSS - DESCRIPTION of Object
=head1 SYNOPSIS
Give standard usage here
=head1 DESCRIPTION
Describe the object here
=head1 FEEDBACK
=head2 Mailing Lists
User feedback is an integral part of the evolution of this and other
Bioperl modules. Send your comments and suggestions preferably to
the Bioperl mailing list. Your participation is much appreciated.
bioperl-l@bioperl.org - General discussion
http://bioperl.org/wiki/Mailing_lists - About the mailing lists
=head2 Support
Please direct usage questions or support issues to the mailing list:
I<bioperl-l@bioperl.org>
rather than to the module maintainer directly. Many experienced and
reponsive experts will be able look at the problem and quickly
address it. Please include a thorough description of the problem
with code and data examples if at all possible.
=head2 Reporting Bugs
Report bugs to the Bioperl bug tracking system to help us keep track
of the bugs and their resolution. Bug reports can be submitted via
the web:
http://redmine.open-bio.org/projects/bioperl/
=head1 AUTHOR - Albert Vilella
Email avilella-AT-gmail-DOT-com
Describe contact details here
=head1 CONTRIBUTORS
Additional contributors names and emails here
=head1 APPENDIX
The rest of the documentation details each of the object methods.
Internal methods are usually preceded with a _
=cut
# Let the code begin...
package Bio::Installer::EMBOSS;
use vars qw(@ISA %DEFAULTS);
use strict;
# Object preamble - inherits from Bio::Root::Root
use Bio::Root::Root;
use Bio::Installer::Generic;
@ISA = qw(Bio::Installer::Generic );
BEGIN {
%DEFAULTS =
( 'ORIGIN_DOWNLOAD_DIR' => 'ftp://ftp.uk.embnet.org/pub/EMBOSS/',
'DESTINATION_DOWNLOAD_DIR' => '/tmp',
'DESTINATION_INSTALL_DIR' => "/usr/local",
'PACKAGE_NAME' => 'EMBOSS-latest.tar.gz',
'DIRECTORY_NAME' => 'EMBOSS-2.9.0'
);
}
#FIXME: regexp directory_name so that is not hardcoded
=head2 get_default
Title : get_default
Usage :
Function:
Example :
Returns :
Args :
=cut
sub get_default {
my $self = shift;
my $param = shift;
return $DEFAULTS{$param};
}
=head2 install
Title : install
Usage : $installer->install();
Function:
Example :
Returns :
Args :
=cut
sub install{
my ($self,@args) = @_;
$self->_decompress;
$self->_execute_typical_nix_install;
$self->_remember_env_is_in_path;
}
=head2 _execute_typical_nix_install
Title : _execute_typical_nix_install
Usage :
Function:
Example :
Returns :
Args :
=cut
sub _execute_typical_nix_install{
my ($self,@args) = @_;
my $call;
#FIXME: regexp directory_name so that is not hardcoded, after EMBOSS-latest is downloaded
my $destination = $self->destination_install_dir . "/" . $self->directory_name;
print "\n\nTypical linux install -- configure -- make -- make install (this might take a while)\n\n";sleep 1;
if (($^O =~ /dec_osf|linux|unix|bsd|solaris|darwin/i)) {
chdir $destination or die "Cant cd to $destination $!\n";
print "\n\nCalling configure (this might take a while)\n\n";sleep 1;
$call = "./configure --prefix=$destination";
system("$call") == 0 or $self->throw("Error when trying to run configure");
print "\n\nCalling make (this might take a while)\n\n";sleep 1;
$call = "make";
system("$call") == 0 or $self->throw("Error when trying to run make");
print "\n\nCalling make install (this might take a while)\n\n";sleep 1;
if (-w "$destination") {
$call = "make install";
} else {
print "\n\n You may need administrative password to install\n"
."this program so that bioperl can see it in the binary PATH\n";
$call = "su -c \"make install\"";
}
system("$call") == 0 or $self->throw("Error when trying to run make install");
} else {
$self->throw("_execute_typical_nix not yet implemented in this platform");
}
}
=head2 _remember_env_is_in_path
Title : _remember_env_is_in_path
Usage :
Function:
Example :
Returns :
Args :
=cut
sub _remember_env_is_in_path{
my ($self,@args) = @_;
my $dir;
$dir = $self->destination_install_dir;
unless ($dir =~ m|/usr/local|) {
print STDERR <<END;
You may need to make $dir visible for \$PATH to help bioperl find the
program. This can be done with a symbolic link (as root):
ln -s $dir/bin /usr/local/bin
END
;
}
}
1;
lib/Bio/Installer/Generic.pm deleted 100644 → 0
View file @ cf6bb849
# BioPerl module for Bio::Installer::Generic
#
# Please direct questions and support issues to <bioperl-l@bioperl.org>
#
# Cared for by Albert Vilella
#
# Copyright Albert Vilella
#
# You may distribute this module under the same terms as perl itself
# POD documentation - main docs before the code
=head1 NAME
Bio::Installer::Generic - DESCRIPTION of Object
=head1 SYNOPSIS
Give standard usage here
=head1 DESCRIPTION
Describe the object here
=head1 FEEDBACK
=head2 Mailing Lists
User feedback is an integral part of the evolution of this and other
Bioperl modules. Send your comments and suggestions preferably to
the Bioperl mailing list. Your participation is much appreciated.
bioperl-l@bioperl.org - General discussion
http://bioperl.org/wiki/Mailing_lists - About the mailing lists
=head2 Support
Please direct usage questions or support issues to the mailing list:
I<bioperl-l@bioperl.org>
rather than to the module maintainer directly. Many experienced and
reponsive experts will be able look at the problem and quickly
address it. Please include a thorough description of the problem
with code and data examples if at all possible.
=head2 Reporting Bugs
Report bugs to the Bioperl bug tracking system to help us keep track
of the bugs and their resolution. Bug reports can be submitted via
the web:
http://redmine.open-bio.org/projects/bioperl/
=head1 AUTHOR - Albert Vilella
Email avilella-AT-gmail-DOT-com
Describe contact details here
=head1 CONTRIBUTORS
Additional contributors names and emails here
=head1 APPENDIX
The rest of the documentation details each of the object methods.
Internal methods are usually preceded with a _
=cut
# Let the code begin...
package Bio::Installer::Generic;
use vars qw(@ISA);
use strict;
# Object preamble - inherits from Bio::Root::Root
use Bio::Root::Root;
# Download file
use LWP;
use HTTP::Request::Common;
@ISA = qw(Bio::Root::Root );
=head2 new
Title : new
Usage : my $obj = new Generic();
Function: Builds a new Generic object
Returns : an instance of Generic
Args : -origin_download_dir => from where is going to be downloaded
-destination_download_dir => where is going to be saved
-destination_install_dir => where is going to be installed
-package_name => name of the package to be downloaded
-directory_name => name of the directory once has been decompressed
=cut
sub new {
my($class,@args) = @_;
my $self = $class->SUPER::new(@args);
my ($origin_download_dir,
$destination_download_dir,
$destination_install_dir,
$package_name,
$directory_name) =
$self->_rearrange( [qw(ORIGIN_DOWNLOAD_DIR
DESTINATION_DOWNLOAD_DIR
DESTINATION_INSTALL_DIR
PACKAGE_NAME
DIRECTORY_NAME)],
@args);
defined $origin_download_dir && $self->origin_download_dir($origin_download_dir);
defined $destination_download_dir && $self->destination_download_dir($destination_download_dir);
defined $destination_install_dir && $self->destination_install_dir($destination_install_dir);
defined $package_name && $self->package_name($package_name);
defined $directory_name && $self->directory_name($directory_name);
return $self;
}
=head2 origin_download_dir
Title : origin_download_dir
Usage : $obj->origin_download_dir($newval)
Function:
Example :
Returns : value of origin_download_dir (a scalar)
Args : on set, new value (a scalar or undef, optional)
=cut
sub origin_download_dir{
my $self = shift;
return $self->{'origin_download_dir'} = shift if @_;
return $self->{'origin_download_dir'} || $self->get_default('ORIGIN_DOWNLOAD_DIR');
}
=head2 destination_download_dir
Title : destination_download_dir
Usage : $obj->destination_download_dir($newval)
Function:
Example :
Returns : value of destination_download_dir (a scalar)
Args : on set, new value (a scalar or undef, optional)
=cut
sub destination_download_dir{
my $self = shift;
return $self->{'destination_download_dir'} = shift if @_;
return $self->{'destination_download_dir'} || $self->get_default('DESTINATION_DOWNLOAD_DIR');
}
=head2 destination_install_dir
Title : destination_install_dir
Usage : $obj->destination_install_dir($newval)
Function:
Example :
Returns : value of destination_install_dir (a scalar)
Args : on set, new value (a scalar or undef, optional)
=cut
sub destination_install_dir{
my $self = shift;
return $self->{'destination_install_dir'} = shift if @_;
return $self->{'destination_install_dir'} || $self->get_default('DESTINATION_INSTALL_DIR');
}
=head2 package_name
Title : package_name
Usage : $obj->package_name($newval)
Function:
Example :
Returns : value of package_name (a scalar)
Args : on set, new value (a scalar or undef, optional)
=cut
sub package_name{
my $self = shift;
return $self->{'package_name'} = shift if @_;
return $self->{'package_name'} || $self->get_default('PACKAGE_NAME');
}
=head2 directory_name
Title : directory_name
Usage : $obj->directory_name($newval)
Function:
Example :
Returns : value of directory_name (a scalar)
Args : on set, new value (a scalar or undef, optional)
=cut
sub directory_name{
my $self = shift;
return $self->{'directory_name'} = shift if @_;
return $self->{'directory_name'} || $self->get_default('DIRECTORY_NAME');
}
=head2 env_name
Title : env_name
Usage :
Function:
Example :
Returns :
Args :
=cut
sub env_name{
my $self = shift;
return $self->{'env_name'} = shift if @_;
return $self->{'env_name'} || $self->get_default('ENV_NAME');
}
=head2 _remember_env
Title : _remember_env
Usage :
Function:
Example :
Returns :
Args :
=cut
sub _remember_env{
my ($self,@args) = @_;
my $dir;
$dir = $self->destination_install_dir;
$dir =~ s|/$||;
$dir .= "/" . $self->directory_name . "/" . $self->get_default('BIN_FOLDER');
my $env_name = $self->env_name;
print STDERR <<END;
You will need to enable \$$env_name to help bioperl find the
program. This can be done in (at least) two ways:
1. define an environmental variable \$$env_name:
export $env_name=$dir
or
2. include a definition of an environmental variable $env_name in
every script that will use the program in the corresponding
bioperl module.
BEGIN {\$ENV\{\'$env_name\'\}=$dir; }
END
;
}
=head2 _decompress
Title : _decompress
Usage :
Function:
Example :
Returns :
Args :
=cut
sub _decompress{
my ($self,@args) = @_;
my $call;
my $destination = $self->destination_download_dir . "/" . $self->package_name;;
my $destination_install_dir = $self->destination_install_dir;
if (($^O =~ /dec_osf|linux|unix|bsd|solaris|darwin/i)) {
$call = "tar xzvf $destination --directory=$destination_install_dir";
system("$call") == 0 or $self->throw("Error when trying to decompress package");
$call = "rm -f $destination";
system("$call") == 0 or $self->throw("Error when trying to delete compressed package");
} else {
$self->throw("_decompress not yet implemented in this platform");
}
}
=head2 download
Title : download
Usage : $installer->download();
Function:
Example :
Returns :
Args :
=cut
sub download{
my ($self,@args) = @_;
print "\n\nDownloading package...(this might take a while)\n\n";sleep 1;
my $file = $self->origin_download_dir;
$file =~ s|/$||;
$file .= "/" . $self->package_name;
my $destination = $self->destination_download_dir;
$destination =~ s|/$||;
$destination .= "/" . $self->package_name;;
my $ua = LWP::UserAgent->new;
my $response = $ua->request( GET($file), $destination );
die "Error at $file\n ", $response->status_line, "\n Aborting"
unless $response->is_success;
print "Package successfully downloaded at $destination.\n";
return $self;
}
=head2 uninstall
Title : uninstall
Usage : $installer->uninstall();
Function:
Example :
Returns :
Args :
=cut
sub uninstall{
my ($self,@args) = @_;
my $call;
my $destination = $self->destination_install_dir;
$destination =~ s|/$||;
$destination .= "/" . $self->directory_name;
print "\n\nUninstalling now: this will delete the installed program\n\n";
if (($^O =~ /dec_osf|linux|unix|bsd|solaris|darwin/i)) {
$call = "rm -rf $destination";
system("$call") == 0 or die "Error when trying to delete installed program $?\n";
} else {
$self->throw("uninstall not yet implemented in this platform");
}
return $self;
}
1;
lib/Bio/Installer/Hyphy.pm deleted 100644 → 0
View file @ cf6bb849
# BioPerl module for Bio::Installer::Hyphy
#
# Please direct questions and support issues to <bioperl-l@bioperl.org>
#
# Cared for by Albert Vilella
#
# Copyright Albert Vilella
#
# You may distribute this module under the same terms as perl itself
# POD documentation - main docs before the code
=head1 NAME
Bio::Installer::Hyphy - DESCRIPTION of Object
=head1 SYNOPSIS
Give standard usage here
=head1 DESCRIPTION
Describe the object here
=head1 FEEDBACK
=head2 Mailing Lists
User feedback is an integral part of the evolution of this and other
Bioperl modules. Send your comments and suggestions preferably to
the Bioperl mailing list. Your participation is much appreciated.
bioperl-l@bioperl.org - General discussion
http://bioperl.org/MailList.shtml - About the mailing lists
=head2 Support
Please direct usage questions or support issues to the mailing list:
I<bioperl-l@bioperl.org>
rather than to the module maintainer directly. Many experienced and
reponsive experts will be able look at the problem and quickly
address it. Please include a thorough description of the problem
with code and data examples if at all possible.
=head2 Reporting Bugs
Report bugs to the Bioperl bug tracking system to help us keep track
of the bugs and their resolution. Bug reports can be submitted via
the web:
http://redmine.open-bio.org/projects/bioperl/
=head1 AUTHOR - Albert Vilella
Email avilella-AT-gmail-DOT-com
Describe contact details here
=head1 CONTRIBUTORS
Additional contributors names and emails here
=head1 APPENDIX
The rest of the documentation details each of the object methods.
Internal methods are usually preceded with a _
=cut
# Let the code begin...
package Bio::Installer::Hyphy;
use vars qw(@ISA %DEFAULTS);
use strict;
# Object preamble - inherits from Bio::Root::Root
use Bio::Root::Root;
use Bio::Installer::Generic;
@ISA = qw(Bio::Installer::Generic );
BEGIN {
%DEFAULTS = ( 'ORIGIN_DOWNLOAD_DIR' => 'http://www.hyphy.org/current',
'BIN_FOLDER' => '',
'DESTINATION_DOWNLOAD_DIR' => '/tmp',
'DESTINATION_INSTALL_DIR' => "$ENV{'HOME'}",
'PACKAGE_NAME' => 'HYPHY_Source.tgz',
'DIRECTORY_NAME' => 'HYPHY_Source',
'ENV_NAME' => 'HYPHYDIR',
);
}
=head2 get_default
Title : get_default
Usage :
Function:
Example :
Returns :
Args :
=cut
sub get_default {
my $self = shift;
my $param = shift;
return $DEFAULTS{$param};
}
=head2 install
Title : install
Usage : $installer->install();
Function:
Example :
Returns :
Args :
=cut
sub install{
my ($self,@args) = @_;
my $dir;
$self->_decompress;
$self->_execute_Hyphy_install_script;
$dir = $self->destination_install_dir;
$self->_remember_env;
}
=head2 _execute_Hyphy_install_script
Title : _execute_Hyphy_install_script
Usage :
Function:
Example :
Returns :
Args :
=cut
sub _execute_Hyphy_install_script{
my ($self,@args) = @_;
my $call;
my $destination = $self->destination_install_dir;
$destination =~ s|/$||;
$destination .= "/" . $self->directory_name;
chdir $destination or die "Cant cd to $destination $!\n";
print "\n\nCompiling now... (this might take a while)\n\n";
$call = "sh build.sh MP";
system("$call") == 0 or die "Error when trying to run install script $?\n";
}
1;
lib/Bio/Installer/Muscle.pm deleted 100644 → 0
View file @ cf6bb849
# BioPerl module for Bio::Installer::Muscle
#
# Please direct questions and support issues to <bioperl-l@bioperl.org>
#
# Cared for by Albert Vilella
#
# Copyright Albert Vilella
#
# You may distribute this module under the same terms as perl itself
# POD documentation - main docs before the code
=head1 NAME
Bio::Installer::Muscle - DESCRIPTION of Object
=head1 SYNOPSIS
Give standard usage here
=head1 DESCRIPTION
Describe the object here
=head1 FEEDBACK
=head2 Mailing Lists
User feedback is an integral part of the evolution of this and other
Bioperl modules. Send your comments and suggestions preferably to
the Bioperl mailing list. Your participation is much appreciated.
bioperl-l@bioperl.org - General discussion
http://bioperl.org/MailList.shtml - About the mailing lists
=head2 Support
Please direct usage questions or support issues to the mailing list:
I<bioperl-l@bioperl.org>
rather than to the module maintainer directly. Many experienced and
reponsive experts will be able look at the problem and quickly
address it. Please include a thorough description of the problem
with code and data examples if at all possible.
=head2 Reporting Bugs
Report bugs to the Bioperl bug tracking system to help us keep track
of the bugs and their resolution. Bug reports can be submitted via
the web:
http://redmine.open-bio.org/projects/bioperl/
=head1 AUTHOR - Albert Vilella
Email avilella-AT-gmail-DOT-com
Describe contact details here
=head1 CONTRIBUTORS
Additional contributors names and emails here
=head1 APPENDIX
The rest of the documentation details each of the object methods.
Internal methods are usually preceded with a _
=cut
# Let the code begin...
package Bio::Installer::Muscle;
use vars qw(@ISA %DEFAULTS);
use strict;
# Object preamble - inherits from Bio::Root::Root
use Bio::Root::Root;
use Bio::Installer::Generic;
@ISA = qw(Bio::Installer::Generic );
BEGIN {
%DEFAULTS = ( 'ORIGIN_DOWNLOAD_DIR' => 'http://igs-server.cnrs-mrs.fr/~cnotred/Packages',
'BIN_FOLDER' => 'bin',
'DESTINATION_DOWNLOAD_DIR' => '/tmp',
'DESTINATION_INSTALL_DIR' => "$ENV{'HOME'}",
'PACKAGE_NAME' => 'T-COFFEE_distribution.tar.gz',
'DIRECTORY_NAME' => 'T-COFFEE_distribution_Version_1.37',
'ENV_NAME' => 'MUSCLEDIR',
);
}
=head2 get_default
Title : get_default
Usage :
Function:
Example :
Returns :
Args :
=cut
sub get_default {
my $self = shift;
my $param = shift;
return $DEFAULTS{$param};
}
=head2 install
Title : install
Usage : $installer->install();
Function:
Example :
Returns :
Args :
=cut
sub install{
my ($self,@args) = @_;
my $dir;
$self->_decompress;
$self->_execute_Muscle_install_script;
$dir = $self->destination_install_dir;
$self->_remember_env;
}
=head2 _execute_Muscle_install_script
Title : _execute_Muscle_install_script
Usage :
Function:
Example :
Returns :
Args :
=cut
sub _execute_Muscle_install_script{
my ($self,@args) = @_;
my $call;
my $destination = $self->destination_install_dir;
$destination =~ s|/$||;
$destination .= "/" . $self->directory_name;
chdir $destination or die "Cant cd to $destination $!\n";
print "\n\nCompiling now... (this might take a while)\n\n";
$call = "sh install";
system("$call") == 0 or die "Error when trying to run install script $?\n";
}
1;
lib/Bio/Installer/Probcons.pm deleted 100644 → 0
View file @ cf6bb849
# BioPerl module for Bio::Installer::Probcons
#
# Please direct questions and support issues to <bioperl-l@bioperl.org>
#
# Cared for by Albert Vilella
#
# Copyright Albert Vilella
#
# You may distribute this module under the same terms as perl itself
# POD documentation - main docs before the code
=head1 NAME
Bio::Installer::Probcons - DESCRIPTION of Object
=head1 SYNOPSIS
Give standard usage here
=head1 DESCRIPTION
Describe the object here
=head1 FEEDBACK
=head2 Mailing Lists
User feedback is an integral part of the evolution of this and other
Bioperl modules. Send your comments and suggestions preferably to
the Bioperl mailing list. Your participation is much appreciated.
bioperl-l@bioperl.org - General discussion
http://bioperl.org/wiki/Mailing_lists - About the mailing lists
=head2 Support
Please direct usage questions or support issues to the mailing list:
I<bioperl-l@bioperl.org>
rather than to the module maintainer directly. Many experienced and
reponsive experts will be able look at the problem and quickly
address it. Please include a thorough description of the problem
with code and data examples if at all possible.
=head2 Reporting Bugs
Report bugs to the Bioperl bug tracking system to help us keep track
of the bugs and their resolution. Bug reports can be submitted via
the web:
http://redmine.open-bio.org/projects/bioperl/
=head1 AUTHOR - Albert Vilella
Email avilella-AT-gmail-DOT-com
Describe contact details here
=head1 CONTRIBUTORS
Additional contributors names and emails here
=head1 APPENDIX
The rest of the documentation details each of the object methods.
Internal methods are usually preceded with a _
=cut
# Let the code begin...
package Bio::Installer::Probcons;
use vars qw(@ISA %DEFAULTS);
use strict;
# Object preamble - inherits from Bio::Root::Root
use Bio::Root::Root;
use Bio::Installer::Generic;
@ISA = qw(Bio::Installer::Generic );
BEGIN {
%DEFAULTS =
( 'ORIGIN_DOWNLOAD_DIR' => 'http://probcons.stanford.edu/',
'DESTINATION_DOWNLOAD_DIR' => '/tmp',
'DESTINATION_INSTALL_DIR' => "/usr/local",
'PACKAGE_NAME' => 'probcons_v1_09.tar.gz',
'DIRECTORY_NAME' => 'probcons'
);
}
=head2 get_default
Title : get_default
Usage :
Function:
Example :
Returns :
Args :
=cut
sub get_default {
my $self = shift;
my $param = shift;
return $DEFAULTS{$param};
}
=head2 install
Title : install
Usage : $installer->install();
Function:
Example :
Returns :
Args :
=cut
sub install{
my ($self,@args) = @_;
$self->_decompress;
$self->_execute_typical_nix_install;
$self->_remember_env_is_in_path;
}
=head2 _execute_typical_nix_install
Title : _execute_typical_nix_install
Usage :
Function:
Example :
Returns :
Args :
=cut
sub _execute_typical_nix_install{
my ($self,@args) = @_;
my $call;
my $destination = $self->destination_install_dir . "/" . $self->directory_name;
print "\n\nTypical linux install -- configure -- make -- make install (this might take a while)\n\n";sleep 1;
if (($^O =~ /dec_osf|linux|unix|bsd|solaris|darwin/i)) {
chdir $destination or die "Cant cd to $destination $!\n";
print "\n\nConfigure not needed\n\n";sleep 1;
# $call = "./configure --prefix=$destination";
# system("$call") == 0 or $self->throw("Error when trying to run configure");
print "\n\nCalling make (this might take a while)\n\n";sleep 1;
$call = "make";
system("$call") == 0 or $self->throw("Error when trying to run make");
# print "\n\nCalling make install (this might take a while)\n\n";sleep 1;
# if (-w "$destination") {
# $call = "make install";
# } else {
# print "\n\n You may need administrative password to install\n"
# ."this program so that bioperl can see it in the binary PATH\n";
# $call = "su -c \"make install\"";
# }
# system("$call") == 0 or $self->throw("Error when trying to run make install");
} else {
$self->throw("_execute_typical_nix not yet implemented in this platform");
}
}
=head2 _remember_env_is_in_path
Title : _remember_env_is_in_path
Usage :
Function:
Example :
Returns :
Args :
=cut
sub _remember_env_is_in_path{
my ($self,@args) = @_;
my $dir;
$dir = $self->destination_install_dir;
unless ($dir =~ m|/usr/local|) {
print STDERR <<END;
You may need to make $dir visible for \$PATH to help bioperl find the
program. This can be done with a symbolic link (as root):
ln -s $dir/bin /usr/local/bin
END
;
}
}
1;
lib/Bio/Installer/SLR.pm deleted 100644 → 0
View file @ cf6bb849
# BioPerl module for Bio::Installer::SLR
#
# Please direct questions and support issues to <bioperl-l@bioperl.org>
#
# Cared for by Albert Vilella
#
# Copyright Albert Vilella
#
# You may distribute this module under the same terms as perl itself
# POD documentation - main docs before the code
=head1 NAME
Bio::Installer::SLR - DESCRIPTION of Object
=head1 SYNOPSIS
Give standard usage here
=head1 DESCRIPTION
Describe the object here
=head1 FEEDBACK
=head2 Mailing Lists
User feedback is an integral part of the evolution of this and other
Bioperl modules. Send your comments and suggestions preferably to
the Bioperl mailing list. Your participation is much appreciated.
bioperl-l@bioperl.org - General discussion
http://bioperl.org/MailList.shtml - About the mailing lists
=head2 Support
Please direct usage questions or support issues to the mailing list:
I<bioperl-l@bioperl.org>
rather than to the module maintainer directly. Many experienced and
reponsive experts will be able look at the problem and quickly
address it. Please include a thorough description of the problem
with code and data examples if at all possible.
=head2 Reporting Bugs
Report bugs to the Bioperl bug tracking system to help us keep track
of the bugs and their resolution. Bug reports can be submitted via
the web:
http://redmine.open-bio.org/projects/bioperl/
=head1 AUTHOR - Albert Vilella
Email avilella-AT-gmail-DOT-com
Describe contact details here
=head1 CONTRIBUTORS
Additional contributors names and emails here
=head1 APPENDIX
The rest of the documentation details each of the object methods.
Internal methods are usually preceded with a _
=cut
# Let the code begin...
package Bio::Installer::SLR;
use vars qw(@ISA %DEFAULTS);
use strict;
# Object preamble - inherits from Bio::Root::Root
use Bio::Root::Root;
use Bio::Installer::Generic;
@ISA = qw(Bio::Installer::Generic );
BEGIN {
%DEFAULTS = ( 'ORIGIN_DOWNLOAD_DIR' => 'http://www.ebi.ac.uk/goldman-srv/SLR/download/current/',
'BIN_FOLDER' => 'bin',
'DESTINATION_DOWNLOAD_DIR' => '/tmp',
'DESTINATION_INSTALL_DIR' => "$ENV{'HOME'}",
'PACKAGE_NAME' => 'slr_source.tgz',
'DIRECTORY_NAME' => 'slr',
'ENV_NAME' => 'SLRDIR',
);
}
=head2 get_default
Title : get_default
Usage :
Function:
Example :
Returns :
Args :
=cut
sub get_default {
my $self = shift;
my $param = shift;
return $DEFAULTS{$param};
}
=head2 install
Title : install
Usage : $installer->install();
Function:
Example :
Returns :
Args :
=cut
sub install{
my ($self,@args) = @_;
my $dir;
$self->_decompress;
# $self->_execute_slr_install_script;
$dir = $self->destination_install_dir;
$self->_remember_env;
}
=head2 _execute_slr_install_script
Title : _execute_slr_install_script
Usage :
Function:
Example :
Returns :
Args :
=cut
sub _execute_slr_install_script{
my ($self,@args) = @_;
my $call;
my $destination = $self->destination_install_dir;
$destination =~ s|/$||;
$destination .= "/" . $self->directory_name;
chdir $destination or die "Cant cd to $destination $!\n";
print "\n\nCompiling now... (this might take a while)\n\n";
$call = "sh build.sh MP";
system("$call") == 0 or die "Error when trying to run install script $?\n";
}
1;
lib/Bio/Tools/Run/Alignment/Muscle.pm
View file @ 0a45cebf
......@@ -293,12 +293,12 @@ sub align {
return &_run( $self, $infilename, $param_string );
}
=head2 profile
=head2 run_profile
Title : profile
Title : run_profile
Usage : $alnfilename = /t/data/cysprot.msa';
$seqsfilename = 't/data/cysprot.fa';
$aln = $factory->profile($alnfilename,$seqsfilename);
$aln = $factory->run_profile($alnfilename,$seqsfilename);
Function: Perform a profile alignment on a MSA to include more seqs
Returns : Reference to a SimpleAlign object containing the
......@@ -312,7 +312,7 @@ sub align {
=cut
sub profile {
sub run_profile {
my ( $self, $alnfilename, $seqsfilename ) = @_;
# Create input file pointer
......
lib/Bio/Tools/Run/Analysis.pm deleted 100644 → 0
View file @ cf6bb849
This diff is collapsed.
lib/Bio/Tools/Run/AnalysisFactory.pm deleted 100644 → 0
View file @ cf6bb849
#
# BioPerl module for Bio::Tools::Run::AnalysisFactory
#
# Please direct questions and support issues to <bioperl-l@bioperl.org>
#
# Cared for by Martin Senger <martin.senger@gmail.com>
# For copyright and disclaimer see below.
#
# POD documentation - main docs before the code
=head1 NAME
Bio::Tools::Run::AnalysisFactory - A directory of analysis tools
=head1 SYNOPSIS
# list all available analyses from the default location,
# using a default (SOAP) access method
use Bio::Tools::Run::AnalysisFactory;
my $list = Bio::Tools::Run::AnalysisFactory->new();
->available_analyses;
use Data::Dumper; print Dumper ($list);
# ditto, but from a different location
use Bio::Tools::Run::AnalysisFactory;
my $list =
Bio::Tools::Run::AnalysisFactory->new(-location => 'http://somewhere/something')
->available_analyses;
# ...and using a different access method
# (this example is not yet impelmented)
use Bio::Tools::Run::AnalysisFactory;
my $list =
Bio::Tools::Run::AnalysisFactory->new(-location => 'http://somewhere/something',
-access => 'novella')
->available_analyses;
# list available categories of analyses
use Bio::Tools::Run::AnalysisFactory;
my $categories =
Bio::Tools::Run::AnalysisFactory->new();
->available_categories;
use Data::Dumper; print Dumper ($categories);
# show all analyses group by categories
use Bio::Tools::Run::AnalysisFactory;
my $factory = Bio::Tools::Run::AnalysisFactory->new();
foreach $cat ( @{ $factory->available_categories } ) {
my @sublist = @{ $factory->available_analyses ($cat) };
print "$cat:\n\t",
join ("\n\t", @{ $factory->available_analyses ($cat) }),
"\n";
}
# create an analysis object
use Bio::Tools::Run::AnalysisFactory;
$service = Bio::Tools::Run::AnalysisFactory->new();
->create_analysis ('edit.seqret');
$service->run (
#...
)->results;
=head1 DESCRIPTION
The module represents a list of available analysis tools from a given
location using a given access method. Additionally, for any of the
available analyses, it can create an object of type C<Bio::Tools::Run::Analysis>.
The module is a higher-level abstraction whose main job is to load a
'real-work-doing' implementation. Which one is used, it depends on the
C<-access> parameter. The same design is used here as for
C<Bio::Tools::Run::Analysis> module.
There is available a I<SOAP> access to almost all EMBOSS applications,
running at European Bioinformatics Institute.
The documentation of all C<public> methods are to be found
in C<Bio::Factory::AnalysisI>.
=head1 FEEDBACK
=head2 Mailing Lists
User feedback is an integral part of the evolution of this and other
Bioperl modules. Send your comments and suggestions preferably to
the Bioperl mailing list. Your participation is much appreciated.
bioperl-l@bioperl.org - General discussion
http://bioperl.org/wiki/Mailing_lists - About the mailing lists
=head2 Support
Please direct usage questions or support issues to the mailing list:
I<bioperl-l@bioperl.org>
rather than to the module maintainer directly. Many experienced and
reponsive experts will be able look at the problem and quickly
address it. Please include a thorough description of the problem
with code and data examples if at all possible.
=head2 Reporting Bugs
Report bugs to the Bioperl bug tracking system to help us keep track
of the bugs and their resolution. Bug reports can be submitted via the
web:
http://redmine.open-bio.org/projects/bioperl/
=head1 AUTHOR
Martin Senger (martin.senger@gmail.com)
=head1 COPYRIGHT
Copyright (c) 2003, Martin Senger and EMBL-EBI.
All Rights Reserved.
This module is free software; you can redistribute it and/or modify
it under the same terms as Perl itself.
=head1 DISCLAIMER
This software is provided "as is" without warranty of any kind.
=head1 SEE ALSO
=over 4
=item *
http://www.ebi.ac.uk/soaplab/Perl_Client.html
=back
=head1 APPENDIX
Here is the rest of the object methods. Internal methods are preceded
with an underscore _.
=cut
# Let the code begin...
package Bio::Tools::Run::AnalysisFactory;
use vars qw(@ISA $Revision);
use strict;
use Bio::Root::Root;
use Bio::Factory::AnalysisI;
@ISA = qw(Bio::Root::Root Bio::Factory::AnalysisI);
BEGIN {
$Revision = q$Id$;
}
# -----------------------------------------------------------------------------
# Available (understood) parameters:
# -access
# (+ parameters used in guessing an access)
# -----------------------------------------------------------------------------
=head2 new
Usage : my $factory =
Bio::Tools::Run::AnalysisFactory->new(-access => 'soap',
-location => 'http://...');
Returns : a new Bio::Tools::Run::AnalysisFactory object representing a list
of available analyses
Args : There may be additional arguments which are specific
to the access method (see methods 'new' or '_initialize'
of the access-specific implementations (such as module
Bio::Tools::Run::AnalysisFactory::soap for a SOAP-based access).
The recognised and used arguments are:
-access
-location
-httpproxy
-timeout
It builds, populates and returns a new C<Bio::Tools::Run::AnalysisFactory> object. This
is how it is seen from the outside. But in fact, it builds, populates
and returns a more specific lower-level object, for example
C<Bio::Tools::Run::AnalysisFactory::soap> object - which one it is it depends on the C<-access>
parameter.
=over 4
=item -access
It indicates what lower-level module to load. Default is 'soap'.
Other (but future) possibilities are:
-access => 'novella'
-access => 'local'
=item -location
A location of the service. The contents is access-specific (see
details in the lower-level implementation modules).
Default is C<http://www.ebi.ac.uk/soaplab/services> (there are
services running at European Bioinformatics Institute on top of most
of EMBOSS analyses, and on some others).
=item -httpproxy
In addition to the I<location> parameter, you may need to specify also
a location/URL of an HTTP proxy server (if your site requires
one). The expected format is C<http://server:port>. There is no
default value. It is also an access-specific parameter which may not
be used by all access methods.
=item -timeout
For long(er) running jobs the HTTP connection may be time-outed. In
order to avoid it (or, vice-versa, to call timeout sooner) you may
specify C<timeout> with the number of seconds the connection will be
kept alive. Zero means to keep it alive forever. The default value is
two minutes.
=back
=cut
sub new {
my ($caller,@args) = @_;
my $class = ref($caller) || $caller;
if ($class eq 'Bio::Tools::Run::AnalysisFactory') {
# this is called only the first time when somebody calls: 'new
# Bio::Tools::Run::AnalysisFactory (...)', and it actually loads a
# 'real-work-doing' module and call this new() method again
# (unless the loaded module has its own new() method)
my %param = @args;
@param { map { lc $_ } keys %param } = values %param; # lowercase keys
my $access =
$param {'-access'} || # use -access parameter
$class->_guess_access ( \%param ) || # or guess from other parameters
'soap'; # or use a default access method
$access = "\L$access"; # normalize capitalization to lower case
# remember the access method (putting it into @args means that the
# object - when created - will remember it)
push (@args, (-access => $access)) unless $param {'-access'};
# load module with the real implementation - as defined in $access
return undef unless (&_load_access_module ($access));
# this calls this same method new() - but now its object part
# (see the upper branche above) is called
return "Bio::Tools::Run::AnalysisFactory::$access"->new (@args);
} else {
# if $caller is an object, or if it is an underlying
# 'real-work-doing' class (e.g. Bio::Tools::Run::AnalysisFactory::soap)
# then we want to call SUPER to create and bless a new object
my ($self) = $class->SUPER::new (@args);
# now the $self is an empty object - we will populate it from
# the $caller - if $caller is an object (so we do cloning here)
if (ref ($caller)) {
%{ $self } = %{ $caller };
}
# and finally add values from '@args' into the newly created
# object (the values will overwrite the values copied above);
# this is done by calling '_initialize' of the 'real-work-doing'
# class (if there is no one there, there is always an empty one
# in Bio::Root::Root)
$self->_initialize (@args);
return $self;
}
}
# -----------------------------------------------------------------------------
=head2 _load_access_module
Usage : $class->_load_access_module ($access)
Returns : 1 on success, undef on failure
Args : 'access' should contain the last part of the
name of a module who does the real implementation
It does (in the run-time) a similar thing as
require Bio::Tools::Run::AnalysisFactory::$access
It prints an error on STDERR if it fails to find and load the module
(for example, because of the compilation errors in the module).
=cut
sub _load_access_module {
my ($access) = @_;
my $load = "Bio/Tools/Run/AnalysisFactory/$access.pm";
eval {
require $load;
};
if ( $@ ) {
Bio::Root::Root->throw (<<END);
$load: $access cannot be found or loaded
Exception $@
For more information about the Analysis system please see the Bio::Tools::Run::AnalysisFactory docs.
END
;
return;
}
return 1;
}
# -----------------------------------------------------------------------------
=head2 _guess_access
Usage : $class->_guess_access ($rh_params)
Returns : string with a guessed access protocol (e.g. 'soap'),
or undef if the guessing failed
Args : 'rh_params' is a hash reference containing parameters given
to the 'new' method.
It makes an expert guess what kind of access/transport protocol should
be used to access the underlying analysis. The guess is based on the
parameters in I<rh_params>. Rememeber that this method is called only
if there was no I<-access> parameter which could tell directly what
access method to use.
=cut
sub _guess_access {
my ($class, $rh_params) = @_;
return undef;
}
# -----------------------------------------------------------------------------
=head2 VERSION and Revision
Usage : print $Bio::Tools::Run::AnalysisFactory::VERSION;
print $Bio::Tools::Run::AnalysisFactory::Revision;
=cut
1;
__END__