Commit 2e65c6a6 authored by Dylan Aïssi's avatar Dylan Aïssi

New upstream version 1.0.0

parent ca116ec2
# .gitattributes file
# Folders and files listed here are EXCLUDED from deployment
# when using `git archive` or github release
# Git Files
.gitattributes export-ignore
.gitignore export-ignore
# Development Folder
dev/* export-ignore
# Images
bioSyntax_logo.png export-ignore
# Extra licenses/readme in submodules
vim/README.md export-ignore
vim/LICENSE.md export-ignore
sublime/README.md export-ignore
sublime/LICENSE.md export-ignore
local/*
*.Rproj
*.Rproj.user
.Rhistory
.swp
*.swp
*.sublime-project
examples/vcf/test_1000genomes.vcf
# Contributing to bioSyntax
Thank you for your interest in contributing to bioSyntax!
**bioSyntax** is a syntax highlighting package for computational biology to bring you intuitively close to your data.
If you would like to contribute to **bioSyntax** on GitHub, please follow this set of guidelines to easily get involved.
## Partipation Guidelines
This project adheres to a [code of conduct](https://www.mozilla.org/en-US/about/governance/policies/participation/), and by participating, you are expected to uphold it as well. Please report unacceptable behaviour to [info at bioSyntax.org](mailto:info@bioSyntax.org), or any of the core developers.
## Current Goals
We currently have a handful of things we would like to accomplish during the Sprint. Have a look at our [Sprint master post](https://github.com/bioSyntax/bioSyntax/issues/38) to find out more about them.
For background information to help you start building, please refer to our [manual](https://biosyntax.org/dev).
## How to Submit Changes
Once you've figured out where you'd like to contribute:
1. [Fork](https://help.github.com/articles/fork-a-repo/) the **bioSyntax** repository to make your own version of the project that you can use and modify.
2. Make your changes in the GitHub interface or locally on your own machine, with a text editor/IDE of your choice. If you're making big changes that have a lot of dependencies on other files in the **bioSyntax** repository, consider [using branches](https://www.atlassian.com/git/tutorials/using-branches) for your work. This way, you can keep your repository up-to-date of any other changes made to files that you're using without losing your own work.
3. Once you're done, [submit a pull request](https://www.atlassian.com/git/tutorials/making-a-pull-request). This will let the core developers know you're proposing changes to the project and invites discussion on your changes, in case anything needs to be fixed or improved before committed to the repository.
If you're really new to contributing to open source projects on GitHub, check out this [tutorial](https://egghead.io/courses/how-to-contribute-to-an-open-source-project-on-github).
## How to Report Bugs
We invite you to try out **bioSyntax** and keep an eye out for anything that needs fixing or may cause potential problems in future. Whether it's bugs in the code, errors in content, or even user interface or experience issues, please [report](https://github.com/bioSyntax/bioSyntax/issues) any of these as an issue on the **bioSyntax** repository, so we can all work together to resolve them.
## Communication Channels
Stay in the loop with us through Slack or Discord below:
- [Slack Channel](https://join.slack.com/t/biosyntax/shared_invite/enQtMzU5OTAwNTc0MjI5LTIxNGU4YzQ1ODljZjg0OTE2M2Y5MDY0MjUwOTA4ZjIwMjVjYjgzNTA5ZGM1ZTliNDMwMGUxMmUzOTI3YWMwOTk) (NOTE: Invite link expires on May 13; contact dev team for invites subsequently)
- [Discord Server](https://discord.gg/PAD6y4p) (NOTE: Invite link expires on May 13; contact dev team for invites subsequently)
Alternatively, you may direct any questions you may have to [info at bioSyntax.org](mailto:info@bioSyntax.org), or any of the core developers.
## Developer's Certificate of Origin 1.1
By making a contribution to this project, I certify that:
* (a) The contribution was created in whole or in part by me and I
have the right to submit it under the open source license
indicated in the file; or
* (b) The contribution is based upon previous work that, to the best
of my knowledge, is covered under an appropriate open source
license and I have the right under that license to submit that
work with modifications, whether created in whole or in part
by me, under the same open source license (unless I am
permitted to submit under a different license), as indicated
in the file; or
* (c) The contribution was provided directly to me by some other
person who certified (a), (b) or (c) and I have not modified
it.
* (d) I understand and agree that this project and the contribution
are public and that a record of the contribution (including all
personal information I submit with it, including my sign-off) is
maintained indefinitely and may be redistributed consistent with
this project or the open source license(s) involved.
......@@ -5,14 +5,14 @@
bioSyntax comes with a handy installation script. Simply download the latest release and run:
```
bash bioSyntax_SETUP.sh <editor-of-choice>
bash bioSyntax_INSTALL.sh <editor-of-choice>
# <editors> = vim || less || gedit || sublime
```
{: .language-bash}
**Note**: Some of the installation script requires super-user commands at the moment. If you don't have permissions or don't like this; simply follow the Manual Installation instructions below, but some files will need to be placed in paths accessed via root as well.
**Note**: Some of the installation script requires sudo/admin privileges at the moment. If you don't have permissions or don't like this; simply follow the Manual Installation instructions below, but some files will need to be placed in paths accessed via root as well. For Windows, the script runs best with the [Git Bash terminal](https://git-scm.com/downloads), which may be required to be run as an administrator.
# Manual Installation
......@@ -24,6 +24,13 @@ bioSyntax comes with a handy installation script. Simply download the latest rel
## Sublime
**(Linux / Mac / Win)**
### via Package Control (Easiest, no admin/sudo privileges required):
- Install [Package Control for Sublime](https://packagecontrol.io/installation).
- Once installed, in Sublime, go to `Preferences > Package Control > Package Control: Install Package` and search for `bioSyntax`, and click on it. Package Control will install the syntax files for you.
- Pick the right file type from the drop-down menu at the bottom-right corner of the editor (e.g. fasta) and select the bioSyntax Color Scheme from `Preferences > Color Scheme > bioSyntax`.
### Manual Install (sudo/admin privileges may be required):
0. Install [Sublime Text 3](http://www.sublimetext.com/).
1. Unzip the downloaded bioSyntax release.
......@@ -34,66 +41,64 @@ bioSyntax comes with a handy installation script. Simply download the latest rel
{: .language-bash}
2. Copy the `$bioSyntax/sublime/*.sublime-syntax` files into the Sublime *Packages* folder:
- **Linux**: `~/.config/sublime-text-3/Packages/User/`
- **Windows**: `~/AppData/Roaming/Sublime\ Text\ 3/Packages/User/`
- **Mac**: `/Library/Application\ Support/Sublime\ Text\ 3/Packages/User/`
- **Linux**: `~/.config/sublime-text-3/Packages/bioSyntax/`
- **Windows**: `~/AppData/Roaming/Sublime\ Text\ 3/Packages/bioSyntax/`
- **Mac**: `~/Library/Application\ Support/Sublime\ Text\ 3/Packages/bioSyntax/`
```
cp $bioSyntax/*.sublime-syntax -d <insert-path>
cp $bioSyntax/sublime/*.sublime-syntax -d <insert-path>
```
{: .language-bash}
3. Copy over the `$bioSyntax/sublime/*.sublime-settings` settings and `$bioSyntax/sublime/bioSyntax.tmTheme` theme files
3. Copy over the `$bioSyntax/sublime/bioSyntax.tmTheme` theme file
```
cp $bioSyntax/*.sublime-settings -d <insert-path>
cp $bioSyntax/bioSyntax.tmTheme -d <insert-path>
```
{: .language-bash}
4. Formats should auto-detect; you can select a specific syntax at the drop-menu at the bottom-right corner of the window (e.g. Plain Text)
4. Formats should auto-detect; you can select a specific syntax at the drop-menu at the bottom-right corner of the window (e.g. Plain Text). Select the bioSyntax Color Scheme from the Preferences menu.
5. Restart **Sublime** and you now have pretty formats!
We're working on adding bioSyntax intallation via Sublime's Package Control. (NOT IMPLEMENTED YET)
- Install [Package Control for Sublime](https://packagecontrol.io/installation).
- Once installed, in Sublime, go to `Preferences > Package Control > Package Control: Install Package` and search for `bioSyntax`, and click on it. Package Control will install the syntax files for you.
## gedit
## gedit (sudo/admin privileges may be required):
**(Linux / Win)**
0. Install [Gedit](https://wiki.gnome.org/Apps/Gedit).
1. Unzip the downloaded bioSyntax release.
2. In bioSyntax folder copy gedit style, `$bioSyntax/gedit/bioSyntax.xml`, file to the appropriate gtksourceview styles folder.
- **Linux**: `/usr/share/gtksourceview-3.0/styles/`
- **Linux**: `"HOME/.local/share/gtksourceview-3.0/styles`
- **Windows**: `/c/Program\ Files/gedit/share/gtksourceview-3.0/styles/`
```
sudo cp $bioSyntax/gedit/bioSyntax.xml <insert-path>
cp $bioSyntax/gedit/bioSyntax.xml <insert-path>
```
{: .language-bash}
3. Copy the gedit `*.lang` files to the appropriate gtksourceview language-spec folder.
- **Linux**: `/usr/share/gtksourceview-3.0/language-specs/`
- **Windows**: `/c/Program\ Files/gedit/share/gtksourceview-3.0/language-specs/`
- **Linux**: `$HOME/.local/share/gtksourceview-3.0/language-specs`
- **Windows**: `/c/Program\ Files/gedit/share/gtksourceview-3.0/language-specs`
```
sudo cp $bioSyntax/gedit/*.lang <insert-path>
cp $bioSyntax/gedit/*.lang <insert-path>
```
{: .language-bash}
4. Restart `gedit` and select the bioSyntax theme
`Edit > Preferences > Font & Color > bioSyntax'`
`Edit > Preferences > Font & Color > bioSyntax`
5. You now have pretty formats!
## vim
**(Linux / Mac / Win)**
### via Pathogen
### via Pathogen (Easiest installation, may require sudo/admin privileges):
If you have [Pathogen](https://github.com/tpope/vim-pathogen) installed:
If you have [Pathogen](https://github.com/tpope/vim-pathogen) and [Git](https://git-scm.com/downloads) installed:
```
cd ~/.vim/bundle &&
......@@ -101,7 +106,7 @@ git clone https://github.com/bioSyntax/bioSyntax-vim.git
```
{: .langauge-bash}
### Manual instructions
### Manual instructions (may require sudo/admin privileges)
1. Unzip the downloaded bioSyntax release.
2. Find your **vim profile folder**, and make a `syntax`, `ftdetect`, and `colors` directories in it, if they don't exist.
......@@ -111,6 +116,9 @@ git clone https://github.com/bioSyntax/bioSyntax-vim.git
```
# Linux/Mac
mkdir -p ~/.vim ~/.vim/syntax ~/.vim/ftdetect ~/.vim/colors
# Windows
mkdir -p $HOME/vimfiles $HOME/vimfiles/syntax $HOME/vimfiles/ftdetect $HOME/vimfiles/colors
```
{: .language-bash}
......@@ -119,23 +127,33 @@ git clone https://github.com/bioSyntax/bioSyntax-vim.git
```
# Linux/Mac
touch ~/.vimrc
if ! grep -q "syntax enable" ~/.vimrc; then echo "syntax enable\\n" >> ~/.vimrc; fi
if ! grep -q ":syntax enable" ~/.vimrc; then echo ":syntax enable\\n" >> ~/.vimrc; fi
# Windows
touch $HOME/_vimrc
if ! grep -q ":syntax enable" $HOME/_vimrc; then echo ":syntax enable\\n" >> $HOME/_vimrc; fi
```
{: .language-bash}
4. Copy the vim syntax, auto-detection, and colour files from `bioSyntax/vim` into the respective vim folders:
```
cp $bioSyntax/vim/*.vim ~/.vim/syntax/
# Linux/Mac
cp $bioSyntax/vim/syntax/*.vim ~/.vim/syntax/
cp $bioSyntax/vim/ftdetect/*.vim ~/.vim/ftdetect/
cp $bioSyntax/vim/colors/bioSyntax.vim ~/.vim/colors/
# Windows
cp $bioSyntax/vim/syntax/*.vim $HOME/.vim/syntax/
cp $bioSyntax/vim/ftdetect/*.vim $HOME/.vim/ftdetect/
cp $bioSyntax/vim/colors/bioSyntax.vim $HOME/.vim/colors/
```
{: .language-bash}
5. Restart vim and you now have pretty formats!
NOTE: Syntax-highlighting can be turned off using `:syntax off` or removing the `:syntax enable` line from the `.vimrc/_vimrc` file.
## less
## less (Hardest installation, sudo privileges may be required)
**(Linux, Mac)**
0. Ensure that your applications/packages are up-to-date:
......@@ -167,32 +185,38 @@ git clone https://github.com/bioSyntax/bioSyntax-vim.git
2. Unzip the downloaded bioSyntax release, `$bioSyntax`.
3. In the `$bioSyntax/less/` folder, copy the `biosyntax.outlang` and `biosyntax-vcf.outlang` files to the **source-highlight** folder:
- **Linux**: `/usr/share/source-highlight/`
3. In the `$bioSyntax/less/` folder, copy the `bioSyntax.outlang` and `bioSyntax-vcf.outlang` files to the **source-highlight** folder:
- **Linux**: `$HOME/.local/share/source-highlight`
- **Mac**: `/usr/local/opt/source-highlight/share/source-highlight/`
```
sudo cp $bioSyntax/less/biosyntax.outlang <insert-path>
sudo cp $bioSyntax/less/biosyntax-vcf.outlang <insert-path>
cp $bioSyntax/less/bioSyntax.outlang <insert-path>
cp $bioSyntax/less/bioSyntax-vcf.outlang <insert-path>
```
{: .language-bash}
4. Copy the bioSyntax language definition `*.lang` and style definition `*.style` files to the paths as above:
```
sudo cp $bioSyntax/less/*.style <insert-path>
sudo cp $bioSyntax/less/*.lang <insert-path>
cp $bioSyntax/less/*.style <insert-path>
cp $bioSyntax/less/*.lang <insert-path>
```
{: .language-bash}
5. Find where **source-highlight** installed its `src-hilite-lesspipe.sh` script, and replace it with `$bioSyntax/less/src-hilite-lesspipe_BIO.sh`. Make the script executable.
5. Find where **source-highlight** installed its `src-hilite-lesspipe.sh` script, and replace it with `$bioSyntax/less/src-hilite-lesspipe-bio-<OS>.sh`. Make the script executable.
```
# Ubuntu
sudo cp $bioSyntax/less/src-hilite-lesspipe_BIO.sh \
/usr/share/source-highlight/src-hilite-lesspipe.sh
sudo chmod 755 /usr/share/source-highlight/src-hilite-lesspipe.sh
cp $bioSyntax/less/src-hilite-lesspipe-bio-LINUX.sh \
$HOME/.local/share/source-highlight/src-hilite-lesspipe-bio.sh
chmod 755 $HOME/.local/share/source-highlight/src-hilite-lesspipe-bio.sh
# Mac
cp $bioSyntax/less/src-hilite-lesspipe-bio-MAC.sh \
/usr/local/bin/src-hilite-lesspipe.sh
chmod 755 /usr/local/bin/src-hilite-lesspipe.sh
```
{: .language-bash}
......
# bioSyntax Makefile
# packages the bioSyntax release from the
# git repository.
#
# For a new release be sure to update the release download link
# https://www.bioSyntax.org/release
# (on github/biosyntax/biosyntax-site
# --> `release.md` line 4 )
#-- System Config --
SHELL =/bin/bash
SOURCEDIR = $(PWD)
ZIP = tar -zcvf
ZIP_R = zip -r
PANDOC = pandoc
CD = cd
MKDIR_P = mkdir -p
RM = rm
MV = mv
CP_R = cp -r
#-- bioSyntax Release Config --
version = v0.1.5
release = bioSyntax_$(version)
components = all gedit sublime vim less alt man zip
.PHONY: $(components)
all: $(release) $(components)
$(release):
$(MKDIR_P) $(release)
gedit:
# gedit -----------------------------------------------
$(CP_R) $(SOURCEDIR)/gedit $(release)
#
#
sublime:
# sublime --------------------------------------------
$(CP_R) $(SOURCEDIR)/sublime $(release)
# TODO: Add control to ensure that bioSyntax-sublime
# submodule is downloaded via git
# Create sublime-settings file for each sublime syntax
# {bash script}
$(CD) $(release)/sublime;\
{ \
TEMPLATE='bioSyntax.sublime-settings' ;\
for SYNTAXFILE in $$(ls *.sublime-syntax);\
do SYNTAX=$$(basename -s .sublime-syntax $$SYNTAXFILE) ;\
printf " Making .sublime-settings file for:\t$$SYNTAX\n" ;\
cp $$TEMPLATE $$SYNTAX".sublime-settings" ;\
done;\
}
# Create sublime-package file for release
$(CD) $(release)/sublime;\
$(ZIP_R) bioSyntax.sublime-package *
#
vim:
# vim -------------------------------------------------
$(CP_R) $(SOURCEDIR)/vim $(release)
# TODO: Add control to ensure that bioSyntax-vim
# submodule is downloaded via git
#
less:
# less ------------------------------------------------
$(CP_R) $(SOURCEDIR)/less $(release)
#
alt:
# alt-syntax + examples -------------------------------
$(CP_R) $(SOURCEDIR)/examples $(release)
$(CP_R) $(SOURCEDIR)/alt-syntax $(release)
#
man:
# scripts + manuals -----------------------------------
$(CP_R) INSTALL.md $(release)
$(CP_R) bioSyntax_INSTALL.sh $(release)
$(CP_R) LICENSE.md $(release)
$(CD) dev/man/ ;\
$(PANDOC) man_pdf.md -f markdown -t latex -o ../../$(release)/man.pdf
$(CP_R) dev/man/man_pdf.md $(release)/README.md
#
zip:
# Create zip of release
$(ZIP) $(release).tar.gz $(release)
......@@ -7,12 +7,25 @@ Support in **vim**, **less**, **sublime3** & **gedit** for `.sam`, `.flagstat`,
# [bioSyntax.org](http://biosyntax.org/)
### We'd like to know how bioSyntax can be developed to help your workflow. [Tell us what you think! (~5m)](https://goo.gl/forms/YO89fEPw71JpH3Ac2)
# [Mozilla Sprint 2018 Updates](https://www.mozillapulse.org/entry/655)
- [Find out](https://github.com/bioSyntax/bioSyntax/issues/38) how you can contribute!
- Date: May 10 - May 11 (9:00 am - 5:00 pm PST)
- On-Site Location: Mozilla Vancouver, #209-163 W Hastings St, Vancouver, BC V6B 1H5, Canada (NOTE: No on-site parking available)
- Join us for the pre-Sprint [Demo Call](https://public.etherpad-mozilla.org/p/ol5-demos-b) on Tuesday, May 8, 16:00 UTC to learn more about the project!
**CONTACT:**
- Project Lead: Alyssa Fegen ([alyssafegen at alumni.ubc.ca](mailto:alyssafegen@alumni.ubc.ca)); will be on-site
- [Slack Channel](https://join.slack.com/t/biosyntax/shared_invite/enQtMzU5OTAwNTc0MjI5LTIxNGU4YzQ1ODljZjg0OTE2M2Y5MDY0MjUwOTA4ZjIwMjVjYjgzNTA5ZGM1ZTliNDMwMGUxMmUzOTI3YWMwOTk) (NOTE: Invite link expires on May 13; contact dev team for invites subsequently)
- [Discord Server](https://discord.gg/PAD6y4p) (NOTE: Invite link expires on May 13; contact dev team for invites subsequently)
## Usage
bioSyntax integrates seamlessly with your text editor, recognizing data-type by the file extension or streamed into `less`.
To gain the most insight from your data, read our brief [bioSyntax Manual](http://bioSyntax.org/man).
## [Download Latest Release](https://github.com/bioSyntax/bioSyntax/releases/download/v0.1-beta3/bioSyntax-0.1-beta3.zip)
## [Download Latest Release](https://www.bioSyntax.org/release)
## [Install](http://bioSyntax.org/install)
......@@ -23,9 +36,13 @@ To gain the most insight from your data, read our brief [bioSyntax Manual](http:
*************************************************
### [Collaborate](http://biosyntax.org/dev)
### Code of Conduct
This project is participating in the Mozilla Festival 2018, and as such, respects Mozilla's [community participation guidelines](https://www.mozilla.org/en-US/about/governance/policies/participation/). This serves as a guideline for the behaviour of all participants, remote or local, as well as project leads, facilitators, staff, volunteers, vendors, and anyone else involved in making the Mozilla Global Sprint possible.
### [Collaborate](CONTRIBUTING.md)
Dev Team: [Artem Babaian](https://github.com/ababaian) | [Anicet Ebou](https://github.com/ebedthan) | [Alyssa Fegen](https://github.com/alyeffy) | [Jeffrey Kam](https://github.com/lazypanda10117) | [Gherman Novakovskiy](https://github.com/fransilvion) | [Jasper Wong](https://github.com/Jwong684)
Dev Team: [Artem Babaian](https://github.com/ababaian) | [Anicet Ebou](https://github.com/ebedthan) | [Alyssa Fegen](https://github.com/alyeffy) | [Jeffrey Kam](https://github.com/lazypanda10117) | [Gherman Novakovskiy](https://github.com/fransilvion) | [Li Yao](https://github.com/liyao001) | [Jasper Wong](https://github.com/Jwong684)
Contact us: [info[AT]biosyntax.org](mailto:info@biosyntax.org)
......
This diff is collapsed.
This diff is collapsed.
# Miscellaneous Contributions
This directory contains a number of additional files that may be of interest.
These are not necessary to use bioSyntax, but can improve the system integration.
## Manpage
bioSyntax.7 is a manpage file to be use on Unix-like operating systems.
## AppStream metadata
biosyntax-*.metainfo.xml are [AppStream](https://www.freedesktop.org/wiki/Distributions/AppStream/) files which provide meta-information used by some software centers.
.\"
.TH bioSyntax 7 "April 2018" "0.1"
.SH NAME
bioSyntax \- Syntax Highlighting for Computational Biology.
.SH DESCRIPTION
Syntax highlighting for computational biology to bring you intuitively close to your data.
.br
BioSyntax provides plugins for gedit, less, sublime and vim.
.br
BioSyntax supports .sam, .flagstat, .vcf, .fasta, .fastq, .faidx, .clustal, .pdb, .gtf, .bed files & more.
.br
.SH Debian-based OS
Plugins are not enabled per default.
.TP
\fBgedit
.br
Go into the gedit preferences:
Edit > Preferences > Font & Color > bioSyntax
.TP
\fBless
.br
First, check your shell:
echo $SHELL
# Outputs:
' $SHELL $RCFILE '
# /bin/zsh --> ~/.zshrc
# /bin/sh --> ~/.shrc
# /bin/bash --> ~/.bashrc
Then, append the rc_append.txt file to your corresponding shell configuration file (rc file).
cat /usr/share/doc/biosyntax-less/rc_append.txt >> ~/.zshrc
.TP
\fBvim
.br
To enable it for your user account just execute:
vim-addons install biosyntax
Similarly, to enable it for all users of this system just execute (as root):
vim-addons -w install biosyntax
vim-addons is provided by the vim-addon-manager package, have a look at its manpage for more information.
.SH SEE ALSO
.BR https://biosyntax.org/
<?xml version="1.0" encoding="UTF-8"?>
<component type="addon">
<id>org.biosyntax.bioSyntax.gedit</id>
<extends>org.gnome.gedit.desktop</extends>
<metadata_license>CC0-1.0</metadata_license>
<project_license>GPL-3.0</project_license>
<name>bioSyntax</name>
<summary>Syntax Highlighting for Computational Biology</summary>
<description>
<p>
Syntax highlighting for computational biology to bring you intuitively close
to your data. BioSyntax supports .sam, .flagstat, .vcf, .fasta, .fastq, .faidx,
.clustal, .pdb, .gtf, .bed files and more. This is a gedit plugin.
</p>
</description>
<url type="homepage">https://biosyntax.org/</url>
<url type="help">https://biosyntax.org/man</url>
<url type="bugtracker">https://github.com/bioSyntax/bioSyntax/issues</url>
</component>
<?xml version="1.0" encoding="UTF-8"?>
<component type="addon">
<id>org.biosyntax.bioSyntax.vim</id>
<extends>vim.desktop</extends>
<metadata_license>CC0-1.0</metadata_license>
<project_license>GPL-3.0</project_license>
<name>bioSyntax</name>
<summary>Syntax Highlighting for Computational Biology</summary>
<description>
<p>
Syntax highlighting for computational biology to bring you intuitively close
to your data. BioSyntax supports .sam, .flagstat, .vcf, .fasta, .fastq, .faidx,
.clustal, .pdb, .gtf, .bed files and more. This is a vim plugin.
</p>
</description>
<url type="homepage">https://biosyntax.org/</url>
<url type="help">https://biosyntax.org/man</url>
<url type="bugtracker">https://github.com/bioSyntax/bioSyntax/issues</url>
</component>
......@@ -5,7 +5,7 @@ chr1 Cufflinks exon 255797 256009 1000 . . gene_id "k562.10070"; transcript_id "
chr1 Cufflinks transcript 728012 728736 1000 . . gene_id "k562.1963"; transcript_id "k562.1963.1"; FPKM "0.0234516682"; frac "1.000000"; conf_lo "0.000000"; conf_hi "0.049253"; cov "0.191666";
chr1 Cufflinks exon 728012 728736 1000 . . gene_id "k562.1963"; transcript_id "k562.1963.1"; exon_number "1"; FPKM "0.0234516682"; frac "1.000000"; conf_lo "0.000000"; conf_hi "0.049253"; cov "0.191666";
chr1 Cufflinks transcript 725503 727560 1000 . . gene_id "k562.1962"; transcript_id "k562.1962.1"; FPKM "0.1293407476"; frac "1.000000"; conf_lo "0.075188"; conf_hi "0.179296"; cov "1.114151";
chr1 Cufflinks exon 725503 727560 1000 . . gene_id "k562.1962"; transcript_id "k562.1962.1"; exon_number "1"; FPKM "0.1293407476"; frac "1.000000"; conf_lo "0.075188"; conf_hi "0.179296"; cov "1.114151";
chr1 Cufflinks exon 725503 727560 1000 . . gene_id "k562.1962"; transcript_id "k562.1962.1"; exon_number "1"; FPKM "0.1293407476"; frac "1.000000"; conf_lo "0.075188"; conf_hi "0.1792 96"; cov "1.114151";
chr1 Cufflinks transcript 729448 732319 1000 . . gene_id "k562.1963"; transcript_id "k562.1963.2"; FPKM "0.0269037848"; frac "1.000000"; conf_lo "0.008289"; conf_hi "0.045589"; cov "0.226483";
chr1 Cufflinks exon 729448 732319 1000 . . gene_id "k562.1963"; transcript_id "k562.1963.2"; exon_number "1"; FPKM "0.0269037848"; frac "1.000000"; conf_lo "0.008289"; conf_hi "0.045589"; cov "0.226483";
chr1 Cufflinks transcript 774493 776245 1000 . . gene_id "k562.2"; transcript_id "k562.2.1"; FPKM "0.1240249269"; frac "1.000000"; conf_lo "0.067900"; conf_hi "0.176541"; cov "1.384263";
......
CLUSTAL
H_sapiens GGAGCCTGCGGCTTAATTTGACTCAACACGGGAAA
P_troglodytes GGAGCCTGCGGCTTAATTTGACTCAACATGGGAAA
G_gallus GGAGCCTGCGGCTTAATTTGACTCAACACGGGAAA
M_musculus GGAGCCTGCGGCTTAATTTGACTCAACACGGGAAA
D_rerio GGAGCCTGCGGCTTAATTTGACTCAACACGGGAAA
D_melanogaster GGAGCCTGCGGCTTAATTTGACTCAACACGGGAAA
C_elegans GGAGCCTGCGGCTTAATTTGACTCAACACGGGAAA
\ No newline at end of file
This diff is collapsed.
## __ __ __ ___
## |__) | / \ /__` \ / |\ | | /\ \_/
## |__) | \__/ .__/ | | \| | /~~\ / \
## __ __ __ ___
## |__) | / \ /__` \ / |\ | | /\ \_/
## |__) | \__/ .__/ | | \| | /~~\ / \
## =======================================
##
## Syntax Highlighting for computational biology rc.append
## Syntax Highlighting for computational biology bp.append
## v0.1
##
## Append this to your ~/.bashprofile in MacOS
## to enable source-highlight for less and add
## bioSyntax pipe capability on your command line
##
export HIGHLIGHT="/usr/local/opt/source-highlight/share/source-highlight"
#export HIGHLIGHT="/usr/local/opt/source-highlight/share/source-highlight"
export LESSOPEN="| /usr/local/bin/src-hilite-lesspipe.sh %s"
export LESS=" -R "
......@@ -24,17 +24,16 @@ alias more='less'
# Explicit call of <file format>-less for piping data
# i.e: samtools view -h aligned_hits.bam | sam-less
# Core syntaxes (default)
alias clustal-less='source-highlight -f esc --lang-def=clustal.lang --outlang-def=bioSyntax.outlang --style-file=fasta.style | less'
alias bed-less='source-highlight -f esc --lang-def=bed.lang --outlang-def=bioSyntax.outlang --style-file=sam.style | less'
alias fa-less='source-highlight -f esc --lang-def=fasta.lang --outlang-def=bioSyntax.outlang --style-file=fasta.style | less'
alias fq-less='source-highlight -f esc --lang-def=fastq.lang --outlang-def=bioSyntax.outlang --style-file=fasta.style | less'
alias gtf-less='source-highlight -f esc --lang-def=gtf.lang --outlang-def=bioSyntax-vcf.outlang --style-file=vcf.style | less'
alias pdb-less='source-highlight -f esc --lang-def=pdb.lang --outlang-def=bioSyntax-vcf.outlang --style-file=pdb.style | less'
alias sam-less='source-highlight -f esc --lang-def=sam.lang --outlang-def=bioSyntax.outlang --style-file=sam.style | less'
alias clustal-less='source-highlight -f esc --lang-def=clustal.lang --outlang-def=bioSyntax.outlang --style-file=fasta.style | less'
alias bed-less='source-highlight -f esc --lang-def=bed.lang --outlang-def=bioSyntax.outlang --style-file=sam.style | less'
alias fa-less='source-highlight -f esc --lang-def=fasta.lang --outlang-def=bioSyntax.outlang --style-file=fasta.style | less'
alias fq-less='source-highlight -f esc --lang-def=fastq.lang --outlang-def=bioSyntax.outlang --style-file=fasta.style | less'
alias gtf-less='source-highlight -f esc --lang-def=gtf.lang --outlang-def=bioSyntax-vcf.outlang --style-file=vcf.style | less'
alias pdb-less='source-highlight -f esc --lang-def=pdb.lang --outlang-def=bioSyntax-vcf.outlang --style-file=pdb.style | less'
alias sam-less='source-highlight -f esc --lang-def=sam.lang --outlang-def=bioSyntax.outlang --style-file=sam.style | less'
alias vcf-less='source-highlight -f esc --lang-def=vcf.lang --outlang-def=bioSyntax-vcf.outlang --style-file=vcf.style | less'
alias bam-less='sam-less'
alias vcf-less='source-highlight -f esc --lang-def=vcf.lang --outlang-def=bioSyntax-vcf.outlang --style-file=vcf.style | less'
# Auxillary syntaxes (uncomment to activate)
#alias fai-less='source-highlight -f esc --lang-def=faidx.lang --outlang-def=bioSyntax.outlang --style-file=sam.style | less'
#alias flagstat-less='source-highlight -f esc --lang-def=flagstat.lang --outlang-def=bioSyntax.outlang --style-file=sam.style | less'
alias fai-less='source-highlight -f esc --lang-def=faidx.lang --outlang-def=bioSyntax.outlang --style-file=sam.style | less'
alias flagstat-less='source-highlight -f esc --lang-def=flagstat.lang --outlang-def=bioSyntax.outlang --style-file=sam.style | less'
#! /bin/bash
# modified for bioSyntax v0.1
for source in "$@"; do
case $source in
*ChangeLog|*changelog)
source-highlight --failsafe -f esc --lang-def=changelog.lang --style-file=esc.style -i "$source" ;;
*Makefile|*makefile)
source-highlight --failsafe -f esc --lang-def=makefile.lang --style-file=esc.style -i "$source" ;;
*.tar|*.tgz|*.gz|*.bz2|*.xz)
lesspipe "$source" ;;
*.clustal)
source-highlight -f esc --lang-def=clustal.lang --outlang-def=bioSyntax.outlang --style-file=fasta.style -i "$source" ;;
*.bed)
source-highlight -f esc --lang-def=bed.lang --outlang-def=bioSyntax.outlang --style-file=sam.style -i "$source" ;;
*.fai|*.faidx)
source-highlight -f esc --lang-def=faidx.lang --outlang-def=bioSyntax.outlang --style-file=sam.style -i "$source" ;;
*.fasta|*.fa|*.mfa)
source-highlight -f esc --lang-def=fasta.lang --outlang-def=bioSyntax.outlang --style-file=fasta.style -i "$source" ;;
*.fastq|*.fq)
source-highlight -f esc --lang-def=fastq.lang --outlang-def=bioSyntax.outlang --style-file=fasta.style -i "$source" ;;
*.flagstat)
source-highlight -f esc --lang-def=flagstat.lang --outlang-def=bioSyntax.outlang --style-file=sam.style -i "$source" ;;
*.gtf)
source-highlight -f esc --lang-def=gtf.lang --outlang-def=bioSyntax-vcf.outlang --style-file=vcf.style -i "$source" ;;
*.pdb)
source-highlight -f esc --lang-def=pdb.lang --outlang-def=bioSyntax-vcf.outlang --style-file=pdb.style -i "$source" ;;
*.sam)
source-highlight -f esc --lang-def=sam.lang --outlang-def=bioSyntax.outlang --style-file=sam.style -i "$source" ;;
*.vcf)
source-highlight -f esc --lang-def=vcf.lang --outlang-def=bioSyntax-vcf.outlang --style-file=vcf.style -i "$source" ;;
*)
source-highlight --failsafe --infer-lang -f esc --style-file=esc.style -i "$source" ;;
esac
done
// GENERIC SYNTAX
// bioSyntax Settings File
// These settings override both User and Default settings
// for this syntax
{
// Sets the colors used within the text area
"color_scheme": "Packages/bioSyntax/bioSyntax.tmTheme",
// Word Wrapping
"word_wrap": false,
// Line Number / Gutter -- User controlled
//"line_numbers": true,
//"gutter": true,
//"margin": 4,
}
%YAML 1.2
---
# Bed syntax highlighting file
# Maintainer: bioSyntax.org
# Version: v0.1
name: bed
file_extensions: [bed]
scope: source.bed