Steffen Möller · Steffen Möller · Steffen Möller · Steffen Möller · Steffen Möller · Steffen Möller
--- a/.gitmodules
+++ b/.gitmodules
+[submodule "third_party/simde"]
+	path = third_party/simde
+	url = https://github.com/nemequ/simde.git
--- a/CMakeLists.txt
+++ b/CMakeLists.txt
@@ -3,11 +3,12 @@ cmake_minimum_required(VERSION 2.8)
 cmake_policy(SET CMP0048 NEW)
 cmake_policy(SET CMP0005 NEW)

-project(bowtie2 LANGUAGES CXX VERSION "2.3.4.3")
+project(bowtie2 LANGUAGES CXX VERSION "2.3.5.1")

 enable_testing()

 include(CTest)
+include(ExternalProject)
 include(ProcessorCount)
 include(CheckSymbolExists)

@@ -18,7 +19,8 @@ option(BOWITE_SHARED_MM "enable shared memory mapping" ON)

 set(CMAKE_CXX_STANDARD 98)
 set(NO_TBB ${NO_TBB})
-set(NO_SPINLOCK, ${NO_SPINLOCK})
+set(NO_SPINLOCK ${NO_SPINLOCK})
+set(USE_SRA 0)
 set(WITH_THREAD_PROFILING ${WITH_THREAD_PROFILING})
 set(POPCNT_CAPABILITY ${POPCNT_CAPABILITY})
 set(CMAKE_CXX_FLAGS "${CMAKE_CXX_FLAGS} -m64 -g3 -Wall -msse2")
@@ -28,6 +30,7 @@ set(INSTALL_DIR "${CMAKE_INSTALL_PREFIX}/bin" CACHE PATH "Installation directory

 set(CMAKE_EXPORT_COMPILE_COMMANDS on)

+
 if (MINGW)
  option(BOWTIE_MM "Memory mapped files not supported on Windows" OFF)
  option(BOWTIE_SHARED_MEM "Shared memory not supported on Windows" OFF)
@@ -35,6 +38,7 @@ endif(MINGW)

 if (APPLE)
  set(CMAKE_XCODE_ATTRIBUTE_DEBUG_INFORMATION_FORMAT "dwarf-with-dsym")
+  set(CMAKE_CXX_FLAGS "${CMAKE_CXX_FLAGS} -stdlib=libc++")
 endif(APPLE)

 set(BOWTIE2_BIN_LIST
@@ -121,6 +125,67 @@ if (POPCNT_CAPABILITY)
  set(CMAKE_CXX_FLAGS "${CMAKE_CXX_FLAGS} -I third_party")
 endif()

+if (USE_SRA)
+  set(NGS_VER 2.9.2)
+  set(NCBI_VDB_VER 2.9.2-1)
+
+  find_package(Java COMPONENTS Development REQUIRED)
+  find_package(PythonInterp REQUIRED)
+  find_package(Perl REQUIRED)
+
+  find_program(MAKE_EXE NAMES gmake nmake make)
+  ExternalProject_add(ngs_project
+    URL https://github.com/ncbi/ngs/archive/${NGS_VER}.tar.gz
+    PREFIX ${CMAKE_CURRENT_BINARY_DIR}/ngs-${NGS_VER}
+    BUILD_IN_SOURCE 1
+    CONFIGURE_COMMAND ./configure --prefix=install
+    BUILD_COMMAND ${MAKE_EXE}
+    INSTALL_COMMAND ${MAKE_EXE} install
+    )
+
+  ExternalProject_Get_Property(ngs_project SOURCE_DIR)
+  set(NGS_INSTALL_DIR ${SOURCE_DIR}/ngs-sdk/install)
+
+  link_directories(${NGS_INSTALL_DIR}/lib64)
+  include_directories(${NGS_INSTALL_DIR}/include)
+
+  add_library(ngs-c++-static STATIC IMPORTED)
+  add_dependencies(ngs-c++-static ngs_project)
+  find_library(LIBNGS_CPP ngs-c++-static PATHS ${NGS_INSTALL_DIR}/lib64 NO_DEFAULT_PATH)
+  set_property(TARGET ngs-c++-static PROPERTY IMPORTED_LOCATION ${LIBNGS_CPP})
+
+  link_libraries(ngs-c++-static)
+
+  ExternalProject_add(ncbi_vdb_project
+    URL https://github.com/ncbi/ncbi-vdb/archive/${NCBI_VDB_VER}.tar.gz
+    PREFIX ${CMAKE_CURRENT_BINARY_DIR}/ncbi-vdb-${NCBI_VDB_VER}
+    BUILD_IN_SOURCE 1
+    CONFIGURE_COMMAND ./configure --prefix=install --with-ngs-sdk=${NGS_INSTALL_DIR}
+    BUILD_COMMAND ${MAKE_EXE}
+    INSTALL_COMMAND ${MAKE_EXE} install
+    DEPENDS ngs_project
+    )
+
+  ExternalProject_Get_Property(ncbi_vdb_project SOURCE_DIR)
+  set(NCBI_VDB_INSTALL_DIR ${SOURCE_DIR}/install)
+
+  link_directories(${NCBI_VDB_INSTALL_DIR}/lib64)
+  include_directories(${NCBI_VDB_INSTALL_DIR}/include)
+
+  add_library(ncbi-ngs-c++-static STATIC IMPORTED)
+  add_dependencies(ncbi-ngs-c++-static ncbi_vdb_project)
+  find_library(LIBNCBI_NGS_CPP ncbi-ngs-c++-static PATHS ${NCBI_VDB_INSTALL_DIR}/lib64 NO_DEFAULT_ATH)
+  set_property(TARGET ncbi-ngs-c++-static PROPERTY IMPORTED_LOCATION ${LIBNCBI_NGS_CPP})
+
+  add_library(ncbi-vdb-static STATIC IMPORTED)
+  add_dependencies(ncbi-vdb-static ncbi_vdb_project)
+  find_library(LIBNCBI_VDB ncbi-vdb-static PATHS ${NCBI_VDB_INSTALL_DIR}/lib64 NO_DEFAULT_PATH)
+  set_property(TARGET ncbi-vdb-static PROPERTY IMPORTED_LOCATION ${LIBNCBI_VDB})
+
+  link_libraries(ncbi-ngs-c++-static ncbi-vdb-static)
+  add_definitions(-DUSE_SRA)
+endif()
+
 if (WITH_THREAD_PROFILING)
  add_definitions(-DPER_THREAD_TIMING=1)
 endif()
@@ -129,29 +194,84 @@ if (CMAKE_BUILD_TYPE STREQUAL "Release")
  add_definitions(-DNDEBUG)
 endif()

-find_package(Threads REQUIRED)
 find_package(ZLIB REQUIRED)
-find_path(TBB_INCLUDE_PATH tbb)
-find_library(TBB_LIBRARY_PATH tbb)
-find_library(TBB_MALLOC_LIBRARY_PATH tbbmalloc)

-if (ZLIB_FOUND)
-    link_libraries(${ZLIB_LIBRARIES})
-    include_directories(${ZLIB_INCLUDE_DIRS})
-endif()

-if (Threads_FOUND)
+find_package(Threads REQUIRED)
 link_libraries(Threads::Threads)
-endif()

-if (NOT TBB_LIBRARY_PATH)
+if (NO_TBB)
  set(SHARED_CPPS ${SHARED_CPPS} tinythread.cpp)
 else()
-    if (NOT NO_QUEUELOCK)
-        add_definitions(-DWITH_TBB -DWITH_QUEUELOCK=1 -DNO_SPINLOCK)
+  find_library(TBB_LIB_PATH tbb)
+
+  if (TBB_LIB_PATH)
+    find_path(TBB_INCLUDE_PATH tbb)
+    link_libraries(${TBB_LIB_PATH})
+    find_library(TBBMALLOC_PROXY_LIB_PATH tbbmalloc_proxy)
+    if (NOT TBBMALLOC_PROXY_LIB_PATH)
+      find_library(TBBMALLOC_LIB_PATH tbbmalloc)
+      link_libraries(${TBBMALLOC_LIB_PATH})
+    else()
+      link_libraries(${TBBMALLOC_PROXY_LIB_PATH})
    endif()
    include_directories(${TBB_INCLUDE_PATH})
-    link_libraries(${TBB_LIBRARY_PATH} ${TBB_MALLOC_LIBRARY_PATH})
+  else()
+    set(TBB_VER 2019_U4)
+
+    if (CMAKE_SYSTEM_NAME STREQUAL Linux)
+      set(tbb_os linux)
+    elseif (CMAKE_SYSTEM_NAME STREQUAL Darwin)
+      set(tbb_os macos)
+    elseif (CMAKE_SYSTEM_NAME STREQUAL Windows)
+      set(tbb_os windows)
+    else()
+      set(tbb_os ${CMAKE_SYSTEM_NAME})
+    endif()
+
+    find_program(MAKE_EXE NAMES gmake nmake make)
+    ExternalProject_Add(tbb_project
+      URL https://github.com/01org/tbb/archive/2019_U4.tar.gz
+      PREFIX ${CMAKE_CURRENT_BINARY_DIR}/tbb-${TBB_VER}
+      BUILD_IN_SOURCE 1
+      CONFIGURE_COMMAND ""
+      BUILD_COMMAND ${MAKE_EXE} tbb_build_prefix=${TBB_VER} tbb_os=${tbb_os}
+      INSTALL_COMMAND ""
+      PREFIX=${CMAKE_CURRENT_BINARY_DIR}/tbb_project
+      )
+
+    ExternalProject_Get_Property(tbb_project SOURCE_DIR)
+
+    set(TBB_SOURCE_DIR ${SOURCE_DIR})
+    set(TBB_RELEASE_DIR ${TBB_SOURCE_DIR}/build/${TBB_VER}_release)
+    include_directories(${TBB_SOURCE_DIR}/include)
+
+    link_directories(${TBB_RELEASE_DIR})
+    add_library(tbb SHARED IMPORTED)
+    add_dependencies(tbb tbb_project)
+    find_library(LIBTBB tbb PATHS ${TBB_RELEASE_DIR} NO_DEFAULT_PATH)
+    set_property(TARGET tbb PROPERTY IMPORTED_LOCATION ${LIBTBB})
+
+    add_library(tbbmalloc_proxy SHARED IMPORTED)
+    add_dependencies(tbbmalloc_proxy tbb_project)
+    find_library(LIBTBBMALLOC_PROXY tbbmalloc_proxy PATHS ${TBB_RELEASE_DIR} NO_DEFAULT_PATH)
+    if (NOT LIBTBBMALLOC_PROXY)
+      add_library(tbbmalloc SHARED IMPORTED)
+      add_dependencies(tbbmalloc tbb_project)
+      find_library(LIBTBBMALLOC tbbmalloc PATHS ${TBB_RELEASE_DIR} NO_DEFAULT_PATH)
+      set_property(TARGET tbbmalloc PROPERTY IMPORTED_LOCATION ${LIBTBBMALLOC})
+      link_libraries(tbb tbbmalloc)
+    else()
+      set_property(TARGET tbbmalloc_proxy PROPERTY IMPORTED_LOCATION ${LIBTBBMALLOC_PROXY})
+      link_libraries(tbb tbbmalloc_proxy)
+    endif()
+  endif()
+  add_definitions(-DWITH_TBB -DWITH_QUEUELOCK=1 -DNO_SPINLOCK)
+endif()
+
+if (ZLIB_FOUND)
+  link_libraries(${ZLIB_LIBRARIES})
+  include_directories(${ZLIB_INCLUDE_DIRS})
 endif()

 include_directories(${PROJECT_SOURCE_DIR})
@@ -167,6 +287,6 @@ add_executable(bowtie2-inspect-l ${INSPECT_CPPS} ${SHARED_CPPS})

 set_target_properties(bowtie2-align-l bowtie2-build-l bowtie2-inspect-l PROPERTIES COMPILE_FLAGS "-DBOWTIE2_64BIT_INDEX")
 set_target_properties(bowtie2-inspect-s bowtie2-inspect-l PROPERTIES COMPILE_FLAGS "-DBOWTIE_INSPECT_MAIN")
-set_target_properties(${BOWTIE2_BIN_LIST} PROPERTIES DEBUG_POSTFIX "-debug")
+set_target_properties(${BOWTIE2_BIN_LIST} PROPERTIES DEBUG_POSTFIX -debug)

 add_test(NAME simple-align COMMAND ${PROJECT_SOURCE_DIR}/bowtie2 -x example/index/lambda_virus example/reads/longreads.fq)
--- a/Dockerfile-aarch64
+++ b/Dockerfile-aarch64
+FROM multiarch/ubuntu-debootstrap:arm64-bionic
+
+WORKDIR /build
+COPY . .
+
+RUN uname -a
+RUN apt-get update -qq && \
+  apt-get install -yq --no-install-suggests --no-install-recommends \
+  build-essential \
+  ca-certificates \
+  gcc \
+  git \
+  g++ \
+  make \
+  software-properties-common \
+  zlib1g-dev
+RUN add-apt-repository -y universe && \
+  apt-get install -yq \
+  libtbb-dev
+
+CMD bash
--- a/MANUAL
+++ b/MANUAL
@@ -14,7 +14,7 @@ paired-end alignment modes. Multiple processors can be used
 simultaneously to achieve greater alignment speed.

 Bowtie 2 outputs alignments in SAM format, enabling interoperation with
-a large number of other tools (e.g. SAMtools, GATK) that use SAM. Bowtie
+a large number of other tools (e.g. SAMtools, GATK) that use SAM. Bowtie
 2 is distributed under the GPLv3 license, and it runs on the command
 line under Windows, Mac OS X and Linux.

@@ -46,7 +46,7 @@ The chief differences between Bowtie 1 and Bowtie 2 are:

 1.  For reads longer than about 50 bp Bowtie 2 is generally faster, more
    sensitive, and uses less memory than Bowtie 1. For relatively short
-    reads ( e.g. less than 50 bp) Bowtie 1 is sometimes faster and/or
+    reads (e.g. less than 50 bp) Bowtie 1 is sometimes faster and/or
    more sensitive.

 2.  Bowtie 2 supports gapped alignment with affine gap penalties. Number
@@ -63,7 +63,7 @@ The chief differences between Bowtie 1 and Bowtie 2 are:
 4.  There is no upper limit on read length in Bowtie 2. Bowtie 1 had an
    upper limit of around 1000 bp.

-5.  Bowtie 2 allows alignments to overlap ambiguous characters (e.g. Ns)
+5.  Bowtie 2 allows alignments to overlap ambiguous characters (e.g. Ns)
    in the reference. Bowtie 1 does not.

 6.  Bowtie 2 does away with Bowtie 1’s notion of alignment “stratum”,
@@ -90,7 +90,7 @@ What isn’t Bowtie 2?

 Bowtie 2 is geared toward aligning relatively short sequencing reads to
 long genomes. That said, it handles arbitrarily small reference
-sequences ( e.g. amplicons) and very long reads (i.e. upwards of 10s or
+sequences (e.g. amplicons) and very long reads (i.e. upwards of 10s or
 100s of kilobases), though it is slower in those settings. It is
 optimized for the read lengths and error modes yielded by typical
 Illumina sequencers.
@@ -108,7 +108,7 @@ With Bioconda installed, you should be able to install Bowtie 2 with
 conda install bowtie2.

 Containerized versions of Bowtie 2 are also available via the
-Biocontainers project (e.g. via Docker Hub).
+Biocontainers project (e.g. via Docker Hub).

 You can also download Bowtie 2 sources and binaries from the Download
 section of the Sourceforge site. Binaries are available for the x86_64
@@ -137,57 +137,35 @@ make from the MSYS environment.

 Bowtie 2 can be run on many threads. By default, Bowtie 2 uses the
 Threading Building Blocks library (TBB) for this. If TBB is not
-available on your system (e.g. make prints an error like
+available on your system (e.g. make prints an error like
 tbb/mutex.h: No such file or directory), you can install it yourself
 from source (see Threading Building Blocks library) or install it using
 your operating system’s preferred package manager. The table below list
 some of the commands for a few of the more popular operating systems.

-OS
-Sync Package List
-Search
-Install
-Ubuntu, Mint, Debian
-    apt-get update
+  -----------------------------------------------------------------------
+  Operating System Sync Package   Search           Install
+                   List                            
+  ---------------- -------------- ---------------- ----------------------
+  Ubuntu, Mint,    apt-get update apt-cache search apt-get install
+  Debian                          tbb              libtbb-dev

-    apt-cache search tbb
+  Fedora, CentOS   yum            yum search tbb   yum install
+                   check-update                    tbb-devel.x86_64

-    apt-get install libtbb-dev
+  Arch             packman -Sy    pacman -Ss tbb   pacman -S
+                                                   extra/intel-tbb

-Fedora, CentOS
-    yum check-update
+  Gentoo           emerge –sync   emerge –search   emerge dev-cpp/tbb
+                                  tbb              

-yum search tbb
+  macOS            brew update    brew search tbb  brew install tbb

-    yum install tbb-devel.x86_64
+  FreeBSD          pkg update     pkg search tbb   pkg install tbb-2019.1
+  -----------------------------------------------------------------------

-Arch
-    packman -Sy
-
-    pacman -Ss tbb
-
-    pacman -S extra/intel-tbb
-
-Gentoo
-    emerge --sync
-
-    emerge --search tbb
-
-    emerge dev-cpp/tbb
-
-MacOS
-    brew update
-
-    brew search tbb
-
-    brew install tbb
-
-FreeBSD
-    portsnap fetch update
-
-    make search name=tbb
-
-    cd /usr/ports/devel/tbb && make install && make clean
+If all fails Bowtie 2 can be built with make NO_TBB=1 to use pthreads or
+Windows native multithreading instead.

 The Bowtie 2 Makefile also includes recipes for basic automatic
 dependency management. Running make static-libs && make STATIC_BUILD=1
@@ -195,8 +173,11 @@ will issue a series of commands that will: 1. download TBB and zlib 2.
 compile them as static libraries 3. link the resulting libraries to the
 compiled Bowtie 2 binaries

-If all fails Bowtie 2 can be built with make NO_TBB=1 to use pthreads or
-Windows native multithreading instead.
+As of version 2.3.5 bowtie2 now supports aligning SRA reads. Prepackaged
+builds will include a package that supports SRA. If you’re building
+bowtie2 from source please make sure that the Java runtime is available
+on your system. You can then proceed with the build by running
+make sra-deps && make USE_SRA=1.


 Adding to PATH
@@ -328,7 +309,7 @@ the read and the reference.

 Valid alignments meet or exceed the minimum score threshold

-For an alignment to be considered “valid” (i.e. “good enough”) by Bowtie
+For an alignment to be considered “valid” (i.e. “good enough”) by Bowtie
 2, it must have an alignment score no less than the minimum score
 threshold. The threshold is configurable and is expressed as a function
 of the read length. In end-to-end alignment mode, the default minimum
@@ -846,7 +827,7 @@ alignment to be considered valid, and x is the read length.

 Usage

-    bowtie2 [options]* -x <bt2-idx> {-1 <m1> -2 <m2> | -U <r> | --interleaved <i>} -S [<sam>]
+    bowtie2 [options]* -x <bt2-idx> {-1 <m1> -2 <m2> | -U <r> | --interleaved <i> | --sra-acc <acc> | b <bam>} -S [<sam>]

 Main arguments

@@ -861,7 +842,7 @@ BOWTIE2_INDEXES environment variable.
    -1 <m1>

 Comma-separated list of files containing mate 1s (filename usually
-includes _1), e.g. -1 flyA_1.fq,flyB_1.fq. Sequences specified with this
+includes _1), e.g. -1 flyA_1.fq,flyB_1.fq. Sequences specified with this
 option must correspond file-for-file and read-for-read with those
 specified in <m2>. Reads may be a mix of different lengths. If - is
 specified, bowtie2 will read the mate 1s from the “standard in” or
@@ -870,7 +851,7 @@ specified, bowtie2 will read the mate 1s from the “standard in” or
    -2 <m2>

 Comma-separated list of files containing mate 2s (filename usually
-includes _2), e.g. -2 flyA_2.fq,flyB_2.fq. Sequences specified with this
+includes _2), e.g. -2 flyA_2.fq,flyB_2.fq. Sequences specified with this
 option must correspond file-for-file and read-for-read with those
 specified in <m1>. Reads may be a mix of different lengths. If - is
 specified, bowtie2 will read the mate 2s from the “standard in” or
@@ -883,6 +864,27 @@ e.g. lane1.fq,lane2.fq,lane3.fq,lane4.fq. Reads may be a mix of
 different lengths. If - is specified, bowtie2 gets the reads from the
 “standard in” or “stdin” filehandle.

+    --interleaved
+
+Reads interleaved FASTQ files where the first two records (8 lines)
+represent a mate pair.
+
+    --sra-acc
+
+Reads are SRA accessions. If the accession provided cannot be found in
+local storage it will be fetched from the NCBI database. If you find
+that SRA alignments are long running please rerun your command with the
+-p/--threads parameter set to desired number of threads.
+
+NB: this option is only available if bowtie 2 is compiled with the
+necessary SRA libraries. See Obtaining Bowtie 2 for details.
+
+    -b <bam>
+
+Reads are unaligned BAM records sorted by read name. The
+--align-paired-reads and --preserve-tags options affect the way Bowtie 2
+processes records.
+
    -S <sam>

 File to write SAM alignments to. By default, alignments are written to
@@ -898,11 +900,6 @@ Reads (specified with <m1>, <m2>, <s>) are FASTQ files. FASTQ files
 usually have extension .fq or .fastq. FASTQ is the default format. See
 also: --solexa-quals and --int-quals.

-    --interleaved
-
-Reads interleaved FASTQ files where the first two records (8 lines)
-represent a mate pair.
-
    --tab5

 Each read or pair is on a single line. An unpaired read line is
@@ -1016,7 +1013,8 @@ Same as: -D 10 -R 2 -N 0 -L 22 -i S,0,2.50

    --sensitive

-Same as: -D 15 -R 2 -L 22 -i S,1,1.15 (default in --end-to-end mode)
+Same as: -D 15 -R 2 -N 0 -L 22 -i S,1,1.15 (default in --end-to-end
+mode)

    --very-sensitive

@@ -1053,8 +1051,8 @@ alignment slower (often much slower) but increases sensitivity. Default:

 Sets the length of the seed substrings to align during multiseed
 alignment. Smaller values make alignment slower but more sensitive.
-Default: the --sensitive preset is used by default, which sets -L to 20
-both in --end-to-end mode and in --local mode.
+Default: the --sensitive preset is used by default, which sets -L to 22
+and 20 in --end-to-end mode and in --local mode.

    -i <func>

@@ -1151,9 +1149,9 @@ one end to the other. Rather, some characters may be omitted (“soft
 clipped”) from the ends in order to achieve the greatest possible
 alignment score. The match bonus --ma is used in this mode, and the best
 possible alignment score is equal to the match bonus (--ma) times the
-length of the read. Specifying --local and one of the presets (e.g.
--local --very-fast) is equivalent to specifying the local version of
-the preset (--very-fast-local). This is mutually exclusive with
+length of the read. Specifying --local and one of the presets
+(e.g. --local --very-fast) is equivalent to specifying the local version
+of the preset (--very-fast-local). This is mutually exclusive with
 --end-to-end. --end-to-end is the default mode.

 Scoring options
@@ -1341,6 +1339,18 @@ If one mate alignment overlaps the other at all, consider that to be
 non-concordant. See also: Mates can overlap, contain or dovetail each
 other. Default: mates can overlap in a concordant alignment.

+BAM options
+
+    --align-paired-reads
+
+Bowtie 2 will, by default, attempt to align unpaired BAM reads. Use this
+option to align paired-end reads instead.
+
+    --preserve-tags
+
+Preserve tags from the original BAM record by appending them to the end
+of the corresponding Bowtie 2 SAM output.
+
 Output options

    -t/--time
@@ -1459,7 +1469,7 @@ record, with value set to <text>.

    --rg <text>

-Add <text> (usually of the form TAG:VAL, e.g. SM:Pool1) as a field on
+Add <text> (usually of the form TAG:VAL, e.g. SM:Pool1) as a field on
 the @RG header line. Note: in order for the @RG line to appear, --rg-id
 must also be specified. This is because the ID tag is required by the
 SAM Spec. Specify --rg multiple times to set multiple fields. See the
@@ -2043,7 +2053,7 @@ You will see something like this:
    @HD VN:1.0  SO:unsorted
    @SQ SN:gi|9626243|ref|NC_001416.1|  LN:48502
    @PG ID:bowtie2  PN:bowtie2  VN:2.0.1
-    r1  0   gi|9626243|ref|NC_001416.1| 18401   42  122M    *   0   0   TGAATGCGAACTCCGGGACGCTCAGTAATGTGACGATAGCTGAAAACTGTACGATAAACNGTACGCTGAGGGCAGAAAAAATCGTCGGGGACATTNTAAAGGCGGCGAGCGCGGCTTTTCCG  +"@6<:27(F&5)9)"B:%B+A-%5A?2$HCB0B+0=D<7E/<.03#!.F77@6B==?C"7>;))%;,3-$.A06+<-1/@@?,26">=?*@'0;$:;??G+:#+(A?9+10!8!?()?7C>  AS:i:-5 XN:i:0  XM:i:3  XO:i:0  XG:i:0  NM:i:3  MD:Z:59G13G21G26    YT:Z:UU
+    r1  0   gi|9626243|ref|NC_001416.1| 18401   42  122M    *   0   0   TGAATGCGAACTCCGGGACGCTCAGTAATGTGACGATAGCTGAAAACTGTACGATAAACNGTACGCTGAGGGCAGAAAAAATCGTCGGGGACATTNTAAAGGCGGCGAGCGCGGCTTTTCCG  +"@6<:27(F&5)9"B):%B+A-%5A?2$HCB0B+0=D<7E/<.03#!.F77@6B==?C"7>;))%;,3-$.A06+<-1/@@?,26">=?*@'0;$:;??G+:#+(A?9+10!8!?()?7C>  AS:i:-5 XN:i:0  XM:i:3  XO:i:0  XG:i:0  NM:i:3  MD:Z:59G13G21G26    YT:Z:UU
    r2  0   gi|9626243|ref|NC_001416.1| 8886    42  275M    *   0   0   NTTNTGATGCGGGCTTGTGGAGTTCAGCCGATCTGACTTATGTCATTACCTATGAAATGTGAGGACGCTATGCCTGTACCAAATCCTACAATGCCGGTGAAAGGTGCCGGGATCACCCTGTGGGTTTATAAGGGGATCGGTGACCCCTACGCGAATCCGCTTTCAGACGTTGACTGGTCGCGTCTGGCAAAAGTTAAAGACCTGACGCCCGGCGAACTGACCGCTGAGNCCTATGACGACAGCTATCTCGATGATGAAGATGCAGACTGGACTGC (#!!'+!$""%+(+)'%)%!+!(&++)''"#"#&#"!'!("%'""("+&%$%*%%#$%#%#!)*'(#")(($&$'&%+&#%*)*#*%*')(%+!%%*"$%"#+)$&&+)&)*+!"*)!*!("&&"*#+"&"'(%)*("'!$*!!%$&&&$!!&&"(*"$&"#&!$%'%"#)$#+%*+)!&*)+(""#!)!%*#"*)*')&")($+*%%)!*)!('(%""+%"$##"#+(('!*(($*'!"*('"+)&%#&$+('**$$&+*&!#%)')'(+(!%+ AS:i:-14    XN:i:0  XM:i:8  XO:i:0  XG:i:0  NM:i:8  MD:Z:0A0C0G0A108C23G9T81T46 YT:Z:UU
    r3  16  gi|9626243|ref|NC_001416.1| 11599   42  338M    *   0   0   GGGCGCGTTACTGGGATGATCGTGAAAAGGCCCGTCTTGCGCTTGAAGCCGCCCGAAAGAAGGCTGAGCAGCAGACTCAAGAGGAGAAAAATGCGCAGCAGCGGAGCGATACCGAAGCGTCACGGCTGAAATATACCGAAGAGGCGCAGAAGGCTNACGAACGGCTGCAGACGCCGCTGCAGAAATATACCGCCCGTCAGGAAGAACTGANCAAGGCACNGAAAGACGGGAAAATCCTGCAGGCGGATTACAACACGCTGATGGCGGCGGCGAAAAAGGATTATGAAGCGACGCTGTAAAAGCCGAAACAGTCCAGCGTGAAGGTGTCTGCGGGCGAT  7F$%6=$:9B@/F'>=?!D?@0(:A*)7/>9C>6#1<6:C(.CC;#.;>;2'$4D:?&B!>689?(0(G7+0=@37F)GG=>?958.D2E04C<E,*AD%G0.%$+A:'H;?8<72:88?E6((CF)6DF#.)=>B>D-="C'B080E'5BH"77':"@70#4%A5=6.2/1>;9"&-H6)=$/0;5E:<8G!@::1?2DC7C*;@*#.1C0.D>H/20,!"C-#,6@%<+<D(AG-).?&#0.00'@)/F8?B!&"170,)>:?<A7#1(A@0E#&A.*DC.E")AH"+.,5,2>5"2?:G,F"D0B8D-6$65D<D!A/38860.*4;4B<*31?6  AS:i:-22    XN:i:0  XM:i:8  XO:i:0  XG:i:0  NM:i:8  MD:Z:80C4C16A52T23G30A8T76A41   YT:Z:UU
    r4  0   gi|9626243|ref|NC_001416.1| 40075   42  184M    *   0   0   GGGCCAATGCGCTTACTGATGCGGAATTACGCCGTAAGGCCGCAGATGAGCTTGTCCATATGACTGCGAGAATTAACNGTGGTGAGGCGATCCCTGAACCAGTAAAACAACTTCCTGTCATGGGCGGTAGACCTCTAAATCGTGCACAGGCTCTGGCGAAGATCGCAGAAATCAAAGCTAAGT(=8B)GD04*G%&4F,1'A>.C&7=F$,+#6!))43C,5/5+)?-/0>/D3=-,2/+.1?@->;)00!'3!7BH$G)HG+ADC'#-9F)7<7"$?&.>0)@5;4,!0-#C!15CF8&HB+B==H>7,/)C5)5*+(F5A%D,EA<(>G9E0>7&/E?4%;#'92)<5+@7:A.(BG@BG86@.G AS:i:-1 XN:i:0  XM:i:1  XO:i:0  XG:i:0  NM:i:1  MD:Z:77C106 YT:Z:UU

--- a/MANUAL.markdown
+++ b/MANUAL.markdown
@@ -139,103 +139,17 @@ or install it using your operating system's preferred package manager.
 The table below list some of the commands for a few of the more popular
 operating systems.

-<table>
-<tr><th>OS</th><th>Sync Package List</th><th>Search</th><th>Install</th></tr>
-<tr><td>Ubuntu, Mint, Debian</td>
-<td>
-
-    apt-get update
-
-</td>
-<td>
-
-    apt-cache search tbb
-
-</td>
-<td>
-
-    apt-get install libtbb-dev
-
-</td></tr>
-<tr><td>Fedora, CentOS</td>
-<td>
-
-    yum check-update
-
-</td>
-<td>
-    yum search tbb
-
-</td>
-<td>
-
-    yum install tbb-devel.x86_64
-
-</td></tr>
-<tr><td>Arch</td>
-<td>
-
-    packman -Sy
-
-</td>
-<td>
-
-    pacman -Ss tbb
-
-</td>
-<td>
-
-    pacman -S extra/intel-tbb
-
-</td></tr>
-<tr><td>Gentoo</td>
-<td>
-
-    emerge --sync
-
-</td>
-<td>
-
-    emerge --search tbb
-
-</td>
-<td>
-
-    emerge dev-cpp/tbb
+| Operating System     | Sync Package List | Search               | Install                      |
+|:---------------------|:------------------|:---------------------|:-----------------------------|
+| Ubuntu, Mint, Debian | apt-get update    | apt-cache search tbb | apt-get install libtbb-dev   |
+| Fedora, CentOS       | yum check-update  | yum search tbb       | yum install tbb-devel.x86_64 |
+| Arch                 | packman -Sy       | pacman -Ss tbb       | pacman -S extra/intel-tbb    |
+| Gentoo               | emerge --sync     | emerge --search tbb  | emerge dev-cpp/tbb           |
+| macOS                | brew update       | brew search tbb      | brew install tbb             |
+| FreeBSD              | pkg update        | pkg search tbb       | pkg install tbb-2019.1       |

-</td>
-<tr><td>MacOS</td>
-<td>
-
-    brew update
-
-</td>
-<td>
-
-    brew search tbb
-
-</td>
-<td>
-
-    brew install tbb
-
-</td></tr>
-<tr><td>FreeBSD</td>
-<td>
-
-    portsnap fetch update
-
-</td>
-<td>
-
-    make search name=tbb
-
-</td>
-<td>
-
-    cd /usr/ports/devel/tbb && make install && make clean
-
-</table>
+If all fails Bowtie 2 can be built with `make NO_TBB=1` to use pthreads
+or Windows native multithreading instead.

 The Bowtie 2 Makefile also includes recipes for basic automatic dependency
 management. Running `make static-libs && make STATIC_BUILD=1` will issue
@@ -244,8 +158,10 @@ a series of commands that will:
  2. compile them as static libraries
  3. link the resulting libraries to the compiled Bowtie 2 binaries

-If all fails Bowtie 2 can be built with `make NO_TBB=1` to use pthreads
-or Windows native multithreading instead.
+As of version 2.3.5 bowtie2 now supports aligning SRA reads. Prepackaged
+builds will include a package that supports SRA. If you're building bowtie2
+from source please make sure that the Java runtime is available on your system.
+You can then proceed with the build by running `make sra-deps && make USE_SRA=1`.

 Adding to PATH
 --------------
@@ -875,11 +791,11 @@ considered valid, and `x` is the read length.

 ### Usage

-    bowtie2 [options]* -x <bt2-idx> {-1 <m1> -2 <m2> | -U <r> | --interleaved <i>} -S [<sam>]
+    bowtie2 [options]* -x <bt2-idx> {-1 <m1> -2 <m2> | -U <r> | --interleaved <i> | --sra-acc <acc> | b <bam>} -S [<sam>]

 ### Main arguments

-<table><tr><td>
+<table><tr><td id="bowtie2-options-x">

    -x <bt2-idx>

@@ -890,7 +806,8 @@ any of the index files up to but not including the final `.1.bt2` / `.rev.1.bt2`
 / etc.  `bowtie2` looks for the specified index first in the current directory,
 then in the directory specified in the `BOWTIE2_INDEXES` environment variable.

-</td></tr><tr><td>
+</td></tr>
+<tr><td id="bowtie2-options-1">

    -1 <m1>

@@ -902,7 +819,8 @@ correspond file-for-file and read-for-read with those specified in `<m2>`. Reads
 may be a mix of different lengths. If `-` is specified, `bowtie2` will read the
 mate 1s from the "standard in" or "stdin" filehandle.

-</td></tr><tr><td>
+</td></tr>
+<tr><td id="bowtie2-options-2">

    -2 <m2>

@@ -914,7 +832,8 @@ correspond file-for-file and read-for-read with those specified in `<m1>`. Reads
 may be a mix of different lengths. If `-` is specified, `bowtie2` will read the
 mate 2s from the "standard in" or "stdin" filehandle.

-</td></tr><tr><td>
+</td></tr>
+<tr><td id="bowtie2-options-U">

    -U <r>

@@ -925,7 +844,44 @@ Comma-separated list of files containing unpaired reads to be aligned, e.g.
 If `-` is specified, `bowtie2` gets the reads from the "standard in" or "stdin"
 filehandle.

-</td></tr><tr><td>
+</td></tr>
+<tr><td id="bowtie2-options-interleaved">
+
+    --interleaved
+
+</td><td>
+
+Reads interleaved FASTQ files where the first two records (8 lines)
+represent a mate pair.
+
+</td></tr>
+<tr><td id="bowtie2-options-sra-acc">
+
+    --sra-acc
+
+</td><td>
+
+Reads are SRA accessions. If the accession provided cannot be found in
+local storage it will be fetched from the NCBI database. If you find that
+SRA alignments are long running please rerun your command with the
+[`-p`/`--threads`] parameter set to desired number of threads.
+
+NB: this option is only available if bowtie 2 is compiled with the necessary
+SRA libraries. See [Obtaining Bowtie 2][obtain Bowtie 2] for details.
+
+</td></tr>
+<tr><td id="bowtie2-options-b">
+
+    -b <bam>
+
+</td><td>
+
+Reads are unaligned BAM records sorted by read name.
+The [`--align-paired-reads`] and [`--preserve-tags`] options
+affect the way Bowtie 2 processes records.
+
+</td></tr>
+<tr><td id="bowtie2-options-S">

    -S <sam>

@@ -951,16 +907,6 @@ Reads (specified with `<m1>`, `<m2>`, `<s>`) are FASTQ files.  FASTQ files
 usually have extension `.fq` or `.fastq`.  FASTQ is the default format.  See
 also: [`--solexa-quals`] and [`--int-quals`].

-</td></tr>
-<tr><td id="bowtie2-options-interleaved">
-
-    --interleaved
-
-</td><td>
-
-Reads interleaved FASTQ files where the first two records (8 lines)
-represent a mate pair.
-
 </td></tr>
 <tr><td id="bowtie2-options-tab5">

@@ -1166,7 +1112,7 @@ Same as: `-D 10 -R 2 -N 0 -L 22 -i S,0,2.50`

 </td><td>

-Same as: `-D 15 -R 2 -L 22 -i S,1,1.15` (default in [`--end-to-end`] mode)
+Same as: `-D 15 -R 2 -N 0 -L 22 -i S,1,1.15` (default in [`--end-to-end`] mode)

 </td></tr>
 <tr><td id="bowtie2-options-very-sensitive">
@@ -1244,8 +1190,8 @@ alignment].  Can be set to 0 or 1. Setting this higher makes alignment slower

 Sets the length of the seed substrings to align during [multiseed alignment].
 Smaller values make alignment slower but more sensitive. Default: the
-[`--sensitive`] preset is used by default, which sets `-L` to 20 both in
-[`--end-to-end`] mode and in [`--local`] mode.
+[`--sensitive`] preset is used by default, which sets `-L` to 22 and
+20 in [`--end-to-end`] mode and in [`--local`] mode.

 </td></tr>
 <tr><td id="bowtie2-options-i">
@@ -1670,6 +1616,31 @@ Default: mates can overlap in a concordant alignment.

 </td></tr></table>

+#### BAM options
+
+<table>
+
+<tr><td id="bowtie2-options-align-paired-reads">
+
+    --align-paired-reads
+
+</td><td>
+
+Bowtie 2 will, by default, attempt to align unpaired BAM reads.
+Use this option to align paired-end reads instead.
+
+</td></tr>
+<tr><td id="bowtie2-options-preserve-tags">
+
+    --preserve-tags
+
+</td><td>
+
+Preserve tags from the original BAM record by appending them to the end
+of the corresponding Bowtie 2 SAM output.
+
+</td></tr></table>
+
 #### Output options

 <table>
@@ -2703,7 +2674,7 @@ You will see something like this:
    @HD	VN:1.0	SO:unsorted
    @SQ	SN:gi|9626243|ref|NC_001416.1|	LN:48502
    @PG	ID:bowtie2	PN:bowtie2	VN:2.0.1
-    r1	0	gi|9626243|ref|NC_001416.1|	18401	42	122M	*	0	0	TGAATGCGAACTCCGGGACGCTCAGTAATGTGACGATAGCTGAAAACTGTACGATAAACNGTACGCTGAGGGCAGAAAAAATCGTCGGGGACATTNTAAAGGCGGCGAGCGCGGCTTTTCCG	+"@6<:27(F&5)9)"B:%B+A-%5A?2$HCB0B+0=D<7E/<.03#!.F77@6B==?C"7>;))%;,3-$.A06+<-1/@@?,26">=?*@'0;$:;??G+:#+(A?9+10!8!?()?7C>	AS:i:-5	XN:i:0	XM:i:3	XO:i:0	XG:i:0	NM:i:3	MD:Z:59G13G21G26	YT:Z:UU
+    r1	0	gi|9626243|ref|NC_001416.1|	18401	42	122M	*	0	0	TGAATGCGAACTCCGGGACGCTCAGTAATGTGACGATAGCTGAAAACTGTACGATAAACNGTACGCTGAGGGCAGAAAAAATCGTCGGGGACATTNTAAAGGCGGCGAGCGCGGCTTTTCCG	+"@6<:27(F&5)9"B):%B+A-%5A?2$HCB0B+0=D<7E/<.03#!.F77@6B==?C"7>;))%;,3-$.A06+<-1/@@?,26">=?*@'0;$:;??G+:#+(A?9+10!8!?()?7C>	AS:i:-5	XN:i:0	XM:i:3	XO:i:0	XG:i:0	NM:i:3	MD:Z:59G13G21G26	YT:Z:UU
    r2	0	gi|9626243|ref|NC_001416.1|	8886	42	275M	*	0	0	NTTNTGATGCGGGCTTGTGGAGTTCAGCCGATCTGACTTATGTCATTACCTATGAAATGTGAGGACGCTATGCCTGTACCAAATCCTACAATGCCGGTGAAAGGTGCCGGGATCACCCTGTGGGTTTATAAGGGGATCGGTGACCCCTACGCGAATCCGCTTTCAGACGTTGACTGGTCGCGTCTGGCAAAAGTTAAAGACCTGACGCCCGGCGAACTGACCGCTGAGNCCTATGACGACAGCTATCTCGATGATGAAGATGCAGACTGGACTGC	(#!!'+!$""%+(+)'%)%!+!(&++)''"#"#&#"!'!("%'""("+&%$%*%%#$%#%#!)*'(#")(($&$'&%+&#%*)*#*%*')(%+!%%*"$%"#+)$&&+)&)*+!"*)!*!("&&"*#+"&"'(%)*("'!$*!!%$&&&$!!&&"(*"$&"#&!$%'%"#)$#+%*+)!&*)+(""#!)!%*#"*)*')&")($+*%%)!*)!('(%""+%"$##"#+(('!*(($*'!"*('"+)&%#&$+('**$$&+*&!#%)')'(+(!%+	AS:i:-14	XN:i:0	XM:i:8	XO:i:0	XG:i:0	NM:i:8	MD:Z:0A0C0G0A108C23G9T81T46	YT:Z:UU
    r3	16	gi|9626243|ref|NC_001416.1|	11599	42	338M	*	0	0	GGGCGCGTTACTGGGATGATCGTGAAAAGGCCCGTCTTGCGCTTGAAGCCGCCCGAAAGAAGGCTGAGCAGCAGACTCAAGAGGAGAAAAATGCGCAGCAGCGGAGCGATACCGAAGCGTCACGGCTGAAATATACCGAAGAGGCGCAGAAGGCTNACGAACGGCTGCAGACGCCGCTGCAGAAATATACCGCCCGTCAGGAAGAACTGANCAAGGCACNGAAAGACGGGAAAATCCTGCAGGCGGATTACAACACGCTGATGGCGGCGGCGAAAAAGGATTATGAAGCGACGCTGTAAAAGCCGAAACAGTCCAGCGTGAAGGTGTCTGCGGGCGAT	7F$%6=$:9B@/F'>=?!D?@0(:A*)7/>9C>6#1<6:C(.CC;#.;>;2'$4D:?&B!>689?(0(G7+0=@37F)GG=>?958.D2E04C<E,*AD%G0.%$+A:'H;?8<72:88?E6((CF)6DF#.)=>B>D-="C'B080E'5BH"77':"@70#4%A5=6.2/1>;9"&-H6)=$/0;5E:<8G!@::1?2DC7C*;@*#.1C0.D>H/20,!"C-#,6@%<+<D(AG-).?&#0.00'@)/F8?B!&"170,)>:?<A7#1(A@0E#&A.*DC.E")AH"+.,5,2>5"2?:G,F"D0B8D-6$65D<D!A/38860.*4;4B<*31?6	AS:i:-22	XN:i:0	XM:i:8	XO:i:0	XG:i:0	NM:i:8	MD:Z:80C4C16A52T23G30A8T76A41	YT:Z:UU
    r4	0	gi|9626243|ref|NC_001416.1|	40075	42	184M	*	0	0	GGGCCAATGCGCTTACTGATGCGGAATTACGCCGTAAGGCCGCAGATGAGCTTGTCCATATGACTGCGAGAATTAACNGTGGTGAGGCGATCCCTGAACCAGTAAAACAACTTCCTGTCATGGGCGGTAGACCTCTAAATCGTGCACAGGCTCTGGCGAAGATCGCAGAAATCAAAGCTAAGT(=8B)GD04*G%&4F,1'A>.C&7=F$,+#6!))43C,5/5+)?-/0>/D3=-,2/+.1?@->;)00!'3!7BH$G)HG+ADC'#-9F)7<7"$?&.>0)@5;4,!0-#C!15CF8&HB+B==H>7,/)C5)5*+(F5A%D,EA<(>G9E0>7&/E?4%;#'92)<5+@7:A.(BG@BG86@.G	AS:i:-1	XN:i:0	XM:i:1	XO:i:0	XG:i:0	NM:i:1	MD:Z:77C106	YT:Z:UU
@@ -2846,6 +2817,7 @@ for more details and variations on this process.
 [`--al-gz`]:                                          #bowtie2-options-al
 [`--al-lz4`]:                                         #bowtie2-options-al
 [`--al`]:                                             #bowtie2-options-al
+[`--align-paired-reads`]:                             #bowtie2-options-align-paired-reads
 [`--bmax`]:                                           #bowtie2-build-options-bmax
 [`--bmaxdivn`]:                                       #bowtie2-build-options-bmaxdivn
 [`--dcv`]:                                            #bowtie2-build-options-dcv
@@ -2861,6 +2833,7 @@ for more details and variations on this process.
 [`--ignore-quals`]:                                   #bowtie2-options-ignore-quals
 [`--int-quals`]:                                      #bowtie2-options-int-quals
 [`--interleaved`]:                                    #bowtie2-options-interleaved
+[`--sra-acc`]:                                        #bowtie2-options-sra-acc
 [`--large-index`]:                                    #bowtie2-build-options-large-index
 [`--local`]:                                          #bowtie2-options-local
 [`--ma`]:                                             #bowtie2-options-ma
@@ -2887,6 +2860,7 @@ for more details and variations on this process.
 [`--packed`]:                                         #bowtie2-build-options-p
 [`--phred33`]:                                        #bowtie2-options-phred33-quals
 [`--phred64`]:                                        #bowtie2-options-phred64-quals
+[`--preserve-tags`]:                                  #bowtie2-options-preserve-tags
 [`--qc-filter`]:                                      #bowtie2-options-qc-filter
 [`--qseq`]:                                           #bowtie2-options-qseq
 [`--quiet`]:                                          #bowtie2-options-quiet
@@ -2933,6 +2907,7 @@ for more details and variations on this process.
 <!-- fasta-continuous option does not exist but was added to prevent
 warnings due to the case insensitive nature of markdown URLs -->
 [`-F`/--fasta-continuous]:                            #bowtie2-options-F
+[`-b`]:                                               #bowtie2-options-b
 [`-c`]:                                               #bowtie2-options-c
 [`-f`]:                                               #bowtie2-options-f
 [`-i`]:                                               #bowtie2-options-i

--- a/Makefile
+++ b/Makefile
@@ -31,15 +31,17 @@ CC ?= $(GCC_PREFIX)/gcc$(GCC_SUFFIX)
 CPP ?= $(GCC_PREFIX)/g++$(GCC_SUFFIX)
 CXX ?= $(CPP)
 CXXFLAGS += -std=c++98
+ifeq (aarch64,$(shell uname -m))
+	CXXFLAGS += -fopenmp-simd
+	CPPFLAGS += -Ithird_party/simde
+endif

 HEADERS := $(wildcard *.h)
 BOWTIE_MM := 1
 BOWTIE_SHARED_MEM :=

-ifdef STATIC_BUILD
-	LDFLAGS += -L$(CURDIR)/.tmp/lib
-	CPPFLAGS += -I$(CURDIR)/.tmp/include
-endif
+NGS_VER ?= 2.9.2
+VDB_VER ?= 2.9.2-1

 # Detect Cygwin or MinGW
 WINDOWS :=
@@ -63,6 +65,11 @@ ifneq (,$(findstring Darwin,$(shell uname)))
 	endif
 endif

+ifdef STATIC_BUILD
+	LDFLAGS += -L$(CURDIR)/.tmp/lib
+	CPPFLAGS += -I$(CURDIR)/.tmp/include
+endif
+
 POPCNT_CAPABILITY ?= 1
 ifeq (1, $(POPCNT_CAPABILITY))
 	CXXFLAGS += -DPOPCNT_CAPABILITY
@@ -104,6 +111,9 @@ ifneq (1,$(NO_TBB))
 	LDLIBS += $(PTHREAD_LIB) -ltbb
 	ifdef STATIC_BUILD
 		LDLIBS += -ltbbmalloc
+	ifndef MINGW
+		LDLIBS += -ldl
+	endif
 	else
 		LDLIBS += -ltbbmalloc_proxy
 	endif
@@ -112,6 +122,26 @@ else
 	LDLIBS += $(PTHREAD_LIB)
 endif

+USE_SRA ?=
+ifeq (1, $(USE_SRA))
+ifdef MINGW
+	$(error "SRA binaries cannot be built on MINGW")
+else
+	LDFLAGS += -L$(CURDIR)/.tmp/lib64
+
+	ifndef ($(STATIC_BUILD))
+		CPPFLAGS += -I$(CURDIR)/.tmp/include
+	endif
+
+	LDLIBS += -lncbi-ngs-c++-static
+	LDLIBS += -lngs-c++-static
+	LDLIBS += -lncbi-vdb-static
+	LDLIBS += -ldl
+
+	CXXFLAGS += -DUSE_SRA
+endif
+endif
+
 ifeq (1,$(WITH_THREAD_PROFILING))
 	CXXFLAGS += -DPER_THREAD_TIMING=1
 endif
@@ -174,6 +204,9 @@ endif
 ifeq (amd64,$(shell uname -m))
 	BITS := 64
 endif
+ifeq (aarch64,$(shell uname -m))
+	BITS := 64
+endif
 # msys will always be 32 bit so look at the cpu arch instead.
 ifneq (,$(findstring AMD64,$(PROCESSOR_ARCHITEW6432)))
 	ifeq (1,$(MINGW))
@@ -185,9 +218,14 @@ ifeq (32,$(BITS))
 endif

 SSE_FLAG := -msse2
+M64_FLAG := -m64
+ifeq (aarch64,$(shell uname -m))
+	SSE_FLAG =
+	M64_FLAG =
+endif

-DEBUG_FLAGS    := -O0 -g3 -m64 $(SSE_FLAG)
-RELEASE_FLAGS  := -O3 -m64 $(SSE_FLAG) -funroll-loops -g3
+DEBUG_FLAGS    := -O0 -g3 $(M64_FLAG) $(SSE_FLAG)
+RELEASE_FLAGS  := -O3 $(M64_FLAG) $(SSE_FLAG) -funroll-loops -g3
 NOASSERT_FLAGS := -DNDEBUG
 FILE_FLAGS     := -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE
 DEBUG_DEFS     = -DCOMPILER_OPTIONS="\"$(DEBUG_FLAGS) $(CXXFLAGS)\""
@@ -230,10 +268,12 @@ GENERAL_LIST := $(wildcard scripts/*.sh) \
                $(wildcard scripts/*.pl) \
                doc/manual.html \
                doc/README \
+		Dockerfile-aarch64 \
                doc/style.css \
 		$(wildcard example/index/*.bt2) \
 		$(wildcard example/reads/*.fq) \
 		$(wildcard example/reads/*.pl) \
+		example/reads/combined_reads.bam \
 		example/reference/lambda_virus.fa \
                $(PTHREAD_PKG) \
 		bowtie2 \
@@ -244,6 +284,7 @@ GENERAL_LIST := $(wildcard scripts/*.sh) \
                NEWS \
                MANUAL \
                MANUAL.markdown \
+		README.md \
                TUTORIAL \
                VERSION

@@ -266,6 +307,7 @@ SRC_PKG_LIST = $(wildcard *.h) \
               $(wildcard *.cpp) \
               $(wildcard third_party/*) \
               Makefile \
+               CMakeLists.txt \
               $(GENERAL_LIST)

 ifeq (1,$(WINDOWS))
@@ -284,8 +326,8 @@ both-sanitized: bowtie2-align-s-sanitized bowtie2-build-s-sanitized bowtie2-alig

 DEFS := -fno-strict-aliasing \
        -DBOWTIE2_VERSION="\"`cat VERSION`\"" \
-        -DBUILD_HOST="\"`hostname`\"" \
-        -DBUILD_TIME="\"`date`\"" \
+        -DBUILD_HOST="\"${HOSTNAME:-`hostname`}\"" \
+        -DBUILD_TIME="\"`date -u -r NEWS`\"" \
        -DCOMPILER_VERSION="\"`$(CXX) -v 2>&1 | tail -1`\"" \
        $(FILE_FLAGS) \
        $(PREF_DEF) \
@@ -456,8 +498,8 @@ bowtie2-src-pkg: $(SRC_PKG_LIST)
 	rm -rf .src.tmp

 .PHONY: bowtie2-bin-pkg
-bowtie2-bin-pkg: PKG_DIR := bowtie2-$(VERSION)-$(if $(MACOS),macos,$(if $(MINGW),mingw,linux))-x86_64
-bowtie2-bin-pkg: static-libs $(BIN_PKG_LIST) $(BOWTIE2_BIN_LIST) $(BOWTIE2_BIN_LIST_DBG)
+bowtie2-bin-pkg: PKG_DIR := bowtie2-$(VERSION)-$(if $(USE_SRA),sra-)$(if $(MACOS),macos,$(if $(MINGW),mingw,linux))-x86_64
+bowtie2-bin-pkg: $(BIN_PKG_LIST) $(BOWTIE2_BIN_LIST) $(BOWTIE2_BIN_LIST_DBG)
 	chmod a+x scripts/*.sh scripts/*.pl
 	rm -rf .bin.tmp
 	mkdir -p .bin.tmp/$(PKG_DIR)
@@ -516,32 +558,68 @@ random-test: all perl-deps

 .PHONY: perl-deps
 perl-deps:
-	if [ ! -e .tmp ]; then \
-		DL=$$([ `which wget` ] && echo "wget --no-check-certificate -O-" || echo "curl -L") ; \
-		mkdir .tmp ; \
+	if [ ! -d "$(CURDIR)/.tmp" ]; then \
+		mkdir -p $(CURDIR)/.tmp/include $(CURDIR)/.tmp/lib ; \
+	fi
+	DL=$$( ( which wget >/dev/null 2>&1 && echo "wget --no-check-certificate -O-" ) || echo "curl -L") ; \
 	$$DL http://cpanmin.us | perl - -l $(CURDIR)/.tmp App::cpanminus local::lib ; \
 	eval `perl -I $(CURDIR)/.tmp/lib/perl5 -Mlocal::lib=$(CURDIR)/.tmp` ; \
-		$(CURDIR)/.tmp/bin/cpanm --force Math::Random Clone Test::Deep Sys::Info ; \
-	fi
+	$(CURDIR)/.tmp/bin/cpanm --force File::Which Math::Random Clone Test::Deep Sys::Info ; \

 .PHONY: static-libs
 static-libs:
-	if [[ ! -d $(CURDIR)/.tmp/lib || ! -d $(CURDIR)/.tmp/include ]]; then \
-		mkdir -p $(CURDIR)/.tmp/lib $(CURDIR)/.tmp/include ; \
+	if [ ! -d "$(CURDIR)/.tmp" ] ; then \
+		mkdir -p $(CURDIR)/.tmp/include $(CURDIR)/.tmp/lib ; \
 	fi ; \
-	if [[ `uname` = "Darwin" ]]; then \
+	if [ `uname` = "Darwin" ]; then \
 		export CFLAGS=-mmacosx-version-min=10.9 ; \
 		export CXXFLAGS=-mmacosx-version-min=10.9 ; \
 	fi ; \
-	DL=$$([ `which wget` ] && echo "wget --no-check-certificate" || echo "curl -LOk") ; \
-	mkdir .tmp ; \
-	cd .tmp ; \
+	cd $(CURDIR)/.tmp ; \
+	DL=$$( ( which wget >/dev/null 2>&1 && echo "wget --no-check-certificate" ) || echo "curl -LOk") ; \
+	if [ ! -f "$(CURDIR)/.tmp/include/zlib.h" ] ; then \
 		$$DL https://zlib.net/zlib-1.2.11.tar.gz && tar xzf zlib-1.2.11.tar.gz && cd zlib-1.2.11 ; \
-	$(if $(MINGW), mingw32-make -f win32/Makefile.gcc, ./configure --static && make) && cp libz.a $(CURDIR)/.tmp/lib && cp zconf.h zlib.h $(CURDIR)/.tmp/include ; \
-	cd .. ; \
-	$$DL https://github.com/01org/tbb/archive/2017_U8.tar.gz && tar xzf 2017_U8.tar.gz && cd tbb-2017_U8; \
+		$(if $(MINGW), mingw32-make -f win32/Makefile.gcc, ./configure --static && make) ; \
+		cp zlib.h zconf.h $(CURDIR)/.tmp/include && cp libz.a $(CURDIR)/.tmp/lib ; \
+		rm -f zlib-1.2.11 ; \
+	fi ; \
+	if [ ! -d "$(CURDIR)/.tmp/include/tbb" ] ; then \
+		cd $(CURDIR)/.tmp ; \
+		$$DL https://github.com/01org/tbb/archive/2019_U4.tar.gz && tar xzf 2019_U4.tar.gz && cd tbb-2019_U4; \
 		$(if $(MINGW), mingw32-make compiler=gcc arch=ia64 runtime=mingw, make) extra_inc=big_iron.inc -j4 \
-	&& cp -r include/tbb $(CURDIR)/.tmp/include && cp build/*_release/*.a $(CURDIR)/.tmp/lib
+		&& cp -r include/tbb $(CURDIR)/.tmp/include && cp build/*_release/*.a $(CURDIR)/.tmp/lib ; \
+		rm -f 2019_U4.tar.gz ; \
+	fi
+
+.PHONY: sra-deps
+sra-deps:
+	DL=$$( ( which wget >/dev/null 2>&1 && echo "wget --no-check-certificate" ) || echo "curl -LOk") ; \
+	if [ ! -d "$(CURDIR)/.tmp" ] ; then \
+		mkdir -p $(CURDIR)/.tmp/include $(CURDIR)/.tmp/lib ; \
+	fi ; \
+	if [ `uname` = "Darwin" ]; then \
+		export CFLAGS=-mmacosx-version-min=10.9 ; \
+		export CXXFLAGS=-mmacosx-version-min=10.9 ; \
+	fi ; \
+	if [ ! -f "$(CURDIR)/.tmp/include/ngs/Alignment.hpp" ] ; then \
+		if [ ! -d "$(CURDIR)/.tmp/ngs-$(NGS_VER)/ngs-sdk" ] ; then \
+			cd $(CURDIR)/.tmp ; \
+			$$DL https://github.com/ncbi/ngs/archive/$(NGS_VER).tar.gz ; \
+			tar xzvf $(NGS_VER).tar.gz ; \
+			rm -f $(NGS_VER).tar.gz ; \
+		fi ; \
+		cd $(CURDIR)/.tmp/ngs-$(NGS_VER) && ./configure --prefix=$(CURDIR)/.tmp --build-prefix=`pwd`/build ; \
+		make && make install ; \
+	fi ; \
+	if [ ! -f "$(CURDIR)/.tmp/include/ncbi-vdb/NGS.hpp" ] ; then \
+		if [ ! -d "$(CURDIR)/.tmp/ncbi-vdb-$(VDB_VER)/vdb3" ] ; then \
+			cd $(CURDIR)/.tmp ; \
+	 		$$DL https://github.com/ncbi/ncbi-vdb/archive/$(VDB_VER).tar.gz ; \
+	 		tar zxvf $(VDB_VER).tar.gz ; \
+	 		rm -f $(VDB_VER).tar.gz ; \
+	 	fi ; \
+	 	cd $(CURDIR)/.tmp/ncbi-vdb-$(VDB_VER) && ./configure --prefix=$(CURDIR)/.tmp --build-prefix=`pwd`/build --with-ngs-sdk=$(CURDIR)/.tmp && make && make install ; \
+	 fi ;

 .PHONY: test
 test: simple-test random-test

--- a/NEWS
+++ b/NEWS
@@ -4,7 +4,7 @@ Bowtie 2 NEWS
 Bowtie 2 is available for download from the project website,
 http://bowtie-bio.sf.net/bowtie2 and on Github,
 https://github.com/BenLangmead/bowtie2/releases.  2.0.0-beta1 is
-the first version released to the public and 2.3.3 is the latest
+the first version released to the public and 2.3.5.1 is the latest
 version.  Bowtie 2 is licensed under the GPLv3 license.  See `LICENSE'
 file for details.

@@ -19,6 +19,30 @@ Please report any issues to the Bowtie 2 Github page or using the Sourceforge bu
 Version Release History
 =======================

+Version 2.3.5.1 - Apr 16, 2019
+
+    * Added official support for BAM input files
+    * Added official support for CMake build system
+    * Added changes to Makefile for creating Reproducible builds (via [210](https://github.com/BenLangmead/bowtie2/pull/210))
+    * Fix an issue whereby building on aarch64 would require patching sed commands (via [#243](https://github.com/BenLangmead/bowtie2/pull/243))
+    * Fix an issue whereby `bowtie2` would incorrectly throw an error while processing `--interleaved` input
+
+Version 2.3.5 - Mar 16, 2019
+
+    * Added support for obtaining input reads directly from the Sequence Read Archive, via NCBI's [NGS language bindings](https://github.com/ncbi/ngs).  This is activated via the [`--sra-acc`](manual.shtml#bowtie2-options-sra-acc) option.  This implementation is based on Daehwan Kim's in [HISAT2](https://ccb.jhu.edu/software/hisat2).  Supports both unpaired and paired-end inputs.
+    * Bowtie 2 now compiles on ARM architectures (via [#216](https://github.com/BenLangmead/bowtie2/pull/216))
+    * `--interleaved` can now be combined with FASTA inputs (worked only with FASTQ before)
+    * Fixed issue whereby large indexes were not successfully found in the `$BOWTIE2_INDEXES` directory
+    * Fixed input from FIFOs (e.g. via process substitution) to distinguish gzip-compressed versus uncompressed input
+    * Fixed issue whereby arguments containing `bz2` `lz4` were misinterpretted as files
+    * Fixed several compiler warnings
+    * Fixed issue whereby both ends of a paired-end read could have negative TLEN if they exactly coincided
+    * Fixed issue whereby `bowtie2-build` would hang on end-of-file (via [#228](https://github.com/BenLangmead/bowtie2/pull/228))
+    * Fixed issue whereby wrapper script would sometimes create zombie processes (via [#51](https://github.com/BenLangmead/bowtie2/pull/51))
+    * Fixed issue whereby `bowtie2-build` and `bowtie2-inspect` wrappers would fail on some versions of Python/PyPy
+    * Replaced old, unhelpful `README.md` in the project with a version that includes badges, links and some highlights from the manual
+    * Note: BAM input support and CMake build support both remain experimental, but we expect to finalize them in the next release
+
 Version 2.3.4.3 - Sep 17, 2018

    * Fixed an issue causing `bowtie2-build` and `bowtie2-inspect`

--- a/README
+++ b/README
-Bowtie 2: http://bowtie-bio.sf.net/bowtie2
-
- - See AUTHORS for information about who wrote Bowtie 2 and its various
-   components.
- - See LICENSE for license information.
- - See MANUAL for detailed information on how to use Bowtie 2.
- - See NEWS for information about changes in this and previous versions
-   of Bowtie 2.
--- a/README.md
+++ b/README.md
+
+<!-- badges: start -->
+[![Generic badge](https://img.shields.io/badge/version-2.3.5.1-green.svg)](https://shields.io/)
+[![Build Status](https://travis-ci.org/BenLangmead/bowtie2.svg?branch=master)](https://travis-ci.org/BenLangmead/bowtie2)
+[![License: GPL v3](https://img.shields.io/badge/license-GPLv3-blue.svg)](https://www.gnu.org/licenses/gpl-3.0)
+<!--badges: end -->
+
+## Overview
+
+*Bowtie 2* is an ultrafast and memory-efficient tool for aligning sequencing reads
+to long reference sequences. It is particularly good at aligning reads of about 50
+up to 100s or 1,000s of characters, and particularly good at aligning to relatively
+long (e.g. mammalian) genomes. Bowtie 2 indexes the genome with an FM Index to keep
+its memory footprint small: for the human genome, its memory footprint is typically
+around 3.2 GB. Bowtie 2 supports gapped, local, and paired-end alignment modes.
+
+## Obtaining Bowtie2
+
+*Bowtie 2* is available from various package managers, notably
+[Bioconda](https://anaconda.org/bioconda/bowtie2). With Bioconda installed, you
+should be able to install Bowtie 2 with `conda install bowtie2`.
+
+Containerized versions of Bowtie 2 are also available via the
+[Biocontainers](https://biocontainers.pro/) project (e.g. via
+[Docker Hub](https://hub.docker.com/r/biocontainers/bowtie2/)).
+
+You can also download Bowtie 2 sources and binaries from the "releases" tab on this
+page. Binaries are available for the x86_64 architecture running Linux, Mac OS X,
+and Windows. We are planning on adding experimental support for ARM-64 in an
+upcoming release. If you plan to compile Bowtie 2 yourself, make sure you have the
+[TBB](https://www.threadingbuildingblocks.org/) and [zlib](https://www.zlib.net)
+libraries installed. See the
+[Building from source](http://bowtie-bio.sourceforge.net/bowtie2/manual.shtml#building-from-source)
+section of the manual for details.
+
+## Getting started
+Looking to try out Bowtie 2? Check out the [Bowtie 2 UI](http://bit.ly/bt2ui-beta) (currently in beta).
+
+### Alignment
+`bowtie2` takes a Bowtie 2 index and a set of sequencing read files and outputs a
+set of alignments in SAM format.
+
+"Alignment" is the process by which we discover how and where the read sequences are
+similar to the reference sequence. An “alignment” is a result from this process,
+specifically: an alignment is a way of “lining up” some or all of the characters in
+the read with some characters from the reference in a way that reveals how they’re
+similar. For example:
+
+```
+  Read:      GACTGGGCGATCTCGACTTCG
+             |||||  |||||||||| |||
+  Reference: GACTG--CGATCTCGACATCG
+```
+Where dash symbols represent gaps and vertical bars show where aligned characters match.
+
+We use alignment to make an educated guess as to where a read originated with
+respect to the reference genome. It’s not always possible to determine this with
+certainty. For instance, if the reference genome contains several long stretches of
+As (`AAAAAAAAA` etc.) and the read sequence is a short stretch of As (`AAAAAAA`), we
+cannot know for certain exactly where in the sea of As the read originated.
+
+**Examples**
+```
+# Aligning unpaired reads
+bowtie2 -x example/index/lambda_virus -U example/reads/longreads.fq
+
+# Aligning paired reads
+bowtie2 -x example/index/lambda_virus -1 example/reads/reads_1.fq -2 example/reads/reads_2.fq
+```
+
+### Building an index
+
+`bowtie2-build` builds a Bowtie index from a set of DNA sequences. `bowtie2-build`
+outputs a set of 6 files with suffixes `.1.bt2`, `.2.bt2`, `.3.bt2`, `.4.bt2`,
+`.rev.1.bt2`, and `.rev.2.bt2`. In the case of a large index these suffixes will
+have a `bt2l` termination. These files together constitute the index: they are all
+that is needed to align reads to that reference. The original sequence FASTA files
+are no longer used by Bowtie 2 once the index is built.
+
+Bowtie 2’s `.bt2` index format is different from Bowtie 1’s `.ebwt` format, and they
+are not compatible with each other.
+
+**Examples**
+```
+# Building a small index
+bowtie2-build example/reference/lambda_virus.fa example/index/lambda_virus
+
+# Building a large index
+bowtie2-build --large-index example/reference/lambda_virus.fa example/index/lambda_virus
+```
+
+### Index inpection
+
+`bowtie2-inspect` extracts information from a Bowtie 2 index about what kind of
+index it is and what reference sequences were used to build it. When run without any
+options, the tool will output a FASTA file containing the sequences of the original
+references (with all non-A/C/G/T characters converted to Ns). It can also be used to
+extract just the reference sequence names using the `-n/--names` option or a more
+verbose summary using the `-s/--summary` option.
+
+**Examples**
+```
+# Inspecting a lambda_virus index (small index) and outputting the summary
+bowtie2-inspect --summary example/index/lambda_virus
+
+# Inspecting the entire lambda virus index (large index)
+bowtie2-inspect --large-index example/index/lambda_virus
+```
+
+## Publications
+
+### Bowtie 2 Papers
+
+- Langmead B, Wilks C., Antonescu V., Charles R. __[Scaling read aligners to hundreds of threads on general-purpose processors](https://doi.org/10.1093/bioinformatics/bty648)__. [Bioinformatics](https://academic.oup.com/bioinformatics). bty648.
+
+- Langmead B, Salzberg S. __[Fast gapped-read alignment with Bowtie 2](http://www.nature.com/nmeth/journal/v9/n4/full/nmeth.1923.html)__. [Nature Methods](http://www.nature.com/nmeth). 2012, 9:357-359.
+
+- Langmead B, Trapnell C, Pop M, Salzberg SL. __[Ultrafast and memory-efficient alignment of short DNA sequences to the human genome](http://genomebiology.com/2009/10/3/R25)__. [Genome Biology](http://genomebiology.com/) 10:R25.
+
+### Related Publications
+
+- P. Ferragina, G. Manzini __[Opportunistic data structures with applications](https://ieeexplore.ieee.org/document/892127)__. [IEEE Xplore](http://genomebiology.com/) 10.1109/SFCS.2000.892127
+
+## Related Work
+
+Check out the [Bowtie 2 UI](http://bit.ly/bt2ui-beta), a [shiny](https://shiny.rstudio.com), frontend to the Bowtie 2 command line.
--- a/VERSION
+++ b/VERSION
-2.3.4.3
+2.3.5.1
--- a/aligner_result.h
+++ b/aligner_result.h
@@ -1314,7 +1314,23 @@ public:
 		assert_eq(refid(), omate.refid());
 		getExtendedCoords(st, en, flags);
 		omate.getExtendedCoords(ost, oen, flags);
-		bool imUpstream = st.off() < ost.off();
+		bool imUpstream;
+
+		if (st.off() == ost.off()) {
+			// --ff case
+			if (st.fw() && ost.fw() && readMate1()) {
+				imUpstream = true;
+			} else if (st.fw() && !ost.fw()) {
+				imUpstream = true;
+			} else {
+				imUpstream = false;
+			}
+		} else if (st.off() < ost.off()) {
+			imUpstream = true;
+		} else {
+			imUpstream = false;
+		}
+
 		TRefOff up = std::min(st.off(), ost.off());
 		TRefOff dn = std::max(en.off(), oen.off());
 		assert_geq(dn, up);

--- a/aligner_sw.h
+++ b/aligner_sw.h
@@ -70,7 +70,7 @@
 #include <iostream>
 #include <limits>
 #include "threading.h"
-#include <emmintrin.h>
+#include "sse_wrap.h"
 #include "aligner_sw_common.h"
 #include "aligner_sw_nuc.h"
 #include "ds.h"

--- a/bowtie2
+++ b/bowtie2
@@ -61,10 +61,13 @@ my %signo       = ();
 my @signame     = ();

 sub quote_params {
-    my %params_2_quote = ('--rg' => 1, '--rg-id' => 1,
-                          '-S' => 1, '-U' => 1,
+    my %params_2_quote = ('-S' => 1, '-U' => 1,
                          '-1' => 1, '-2' => 1,
-                          '-x' => 1
+                          '-x' => 1, '-b' => 1,
+                          '--interleaved' => 1,
+                          '--rg' => 1,'--rg-id' => 1,
+                          '--tab5' => 1, '--tab6' => 1,
+                          '--sam-acc' => 1, '--bam' => 1
    );
    my $param_list = shift;
    my $quoting = 0;
@@ -225,7 +228,7 @@ for(my $i = 0; $i < scalar(@bt2_args); $i++) {
 			last;
 		}
 	}
-    if ($arg =~ /(bz2|lz4)$/) {
+        if ($arg =~ /(\.bz2|\.lz4)$/) {
            push @bt2w_args, ("-U", $arg);
            $bt2_args[$i] = undef;
        }
@@ -257,6 +260,7 @@ my @unps = ();
 my @mate1s = ();
 my @mate2s = ();
 my @to_delete = ();
+my @to_kill = ();
 my $temp_dir = "/tmp";
 my $bam_out = 0;
 my $ref_str = undef;
@@ -354,7 +358,8 @@ sub Extract_IndexName_From {
            my @idx_filenames = glob($idx_basename . "*.bt2{,l}");
            unless (@idx_filenames) {
                if (exists $ENV{"BOWTIE2_INDEXES"}) {
-                    @idx_filenames = glob("$ENV{'BOWTIE2_INDEXES'}/$idx_basename" . "bt2{,l}");
+                    @idx_filenames = glob("$ENV{'BOWTIE2_INDEXES'}/$idx_basename" . "*.bt2{,l}");
+                    $idx_basename = $ENV{"BOWTIE2_INDEXES"} . "/" . $idx_basename;
                }

                if (!@idx_filenames) {
@@ -384,7 +389,10 @@ if(wrapInput(\@unps, \@mate1s, \@mate2s)) {
 			mkfifo($m1fn, 0700) || Fail("mkfifo($m1fn) failed.\n");
 		}
 		my $pid = 0;
-		$pid = fork() unless $no_pipes;
+		unless ($no_pipes) {
+			$pid = fork();
+			push @to_kill, $pid if $pid;
+		}
 		if($pid == 0) {
 			# Open named pipe 1 for writing
 			open(my $ofh, ">$m1fn") || Fail("Can't open '$m1fn' for writing\n");
@@ -401,7 +409,10 @@ if(wrapInput(\@unps, \@mate1s, \@mate2s)) {
 			mkfifo($m2fn, 0700) || Fail("mkfifo($m2fn) failed.\n");
 		}
 		$pid = 0;
-		$pid = fork() unless $no_pipes;
+		unless ($no_pipes) {
+			$pid = fork();
+			push @to_kill, $pid if $pid;
+		}
 		if($pid == 0) {
 			# Open named pipe 2 for writing
 			open(my $ofh, ">$m2fn") || Fail("Can't open '$m2fn' for writing.\n");
@@ -423,7 +434,10 @@ if(wrapInput(\@unps, \@mate1s, \@mate2s)) {
 			mkfifo($ufn, 0700) || Fail("mkfifo($ufn) failed.\n");
 		}
 		my $pid = 0;
-		$pid = fork() unless $no_pipes;
+		unless ($no_pipes) {
+			$pid = fork();
+			push @to_kill, $pid if $pid;
+		}
 		if($pid == 0) {
 			# Open named pipe 2 for writing
 			open(my $ofh, ">$ufn") || Fail("Can't open '$ufn' for writing.\n");
@@ -622,6 +636,7 @@ if(defined($cap_out)) {
 	$ret = system($cmd);
 }
 if(!$keep) { for(@to_delete) { unlink($_); } }
+kill 'HUP', @to_kill;

 if ($ret == -1) {
    Error("Failed to execute bowtie2-align: $!\n");

--- a/bowtie2-build
+++ b/bowtie2-build
@@ -84,7 +84,7 @@ def main():
    argv.appendleft('--wrapper')
    argv.appendleft(build_bin_spec)
    logging.info('Command: %s' % ' '.join(argv))
-    sys.exit(subprocess.call(argv))
+    sys.exit(subprocess.call(list(argv)))

 if __name__ == '__main__':
    main()
--- a/bowtie2-inspect
+++ b/bowtie2-inspect
@@ -45,8 +45,8 @@ def main():
    inspect_bin_name      = 'bowtie-inspect'
    inspect_bin_s         = 'bowtie2-inspect-s'
    inspect_bin_l         = 'bowtie2-inspect-l'
-    idx_ext_l             = '.1.bt2l'; 
-    idx_ext_s             = '.1.bt2'; 
+    idx_ext_l             = '.1.bt2l'
+    idx_ext_s             = '.1.bt2'
    curr_script           = os.path.realpath(inspect.getsourcefile(main))
    ex_path               = os.path.dirname(curr_script)
    inspect_bin_spec      = os.path.join(ex_path,inspect_bin_s)
@@ -78,7 +78,7 @@ def main():
    argv.appendleft('--wrapper')
    argv.appendleft(inspect_bin_spec)
    logging.info('Command: %s' %  ' '.join(argv))
-    sys.exit(subprocess.call(argv))
+    sys.exit(subprocess.call(list(argv)))

 if __name__ == '__main__':
    main()
--- a/bt2_io.cpp
+++ b/bt2_io.cpp
@@ -366,6 +366,9 @@ void Ebwt::readIntoMemory(
 					cerr << "Error reading _ebwt[] array: " << r << ", "
 						 << bytesLeft << gLastIOErrMsg << endl;
 					throw 1;
+				} else if (r == 0) {
+					cerr << "Error reading _ebwt[] array: no more data" << endl;
+					throw 1;
 				}
 				pebwt += r;
 				bytesLeft -= r;
@@ -598,6 +601,9 @@ void Ebwt::readIntoMemory(
 								cerr << "Error reading block of _offs[] array: "
 								     << r << ", " << bytesLeft << gLastIOErrMsg << endl;
 								throw 1;
+							} else if (r == 0) {
+								cerr << "Error reading block of _offs[] array: no more data" << endl;
+								throw 1;
 							}
 							offs += r;
 							bytesLeft -= r;

--- a/bt2_search.cpp
+++ b/bt2_search.cpp
@@ -178,7 +178,7 @@ static bool sam_print_zi;
 static bool sam_print_zp;
 static bool sam_print_zu;
 static bool sam_print_zt;
-static bool preserve_sam_tags; // Only applies when aligning BAM files
+static bool preserve_tags;     // Only applies when aligning BAM files
 static bool align_paired_reads; // Process only the paired reads in BAM file
 static bool bwaSwLike;
 static bool gSeedLenIsSet;
@@ -267,6 +267,10 @@ static string bt2index;      // read Bowtie 2 index from files with this prefix
 static EList<pair<int, string> > extra_opts;
 static size_t extra_opts_cur;

+#ifdef USE_SRA
+static EList<string> sra_accs;
+#endif
+
 #define DMAX std::numeric_limits<double>::max()

 static void resetOptions() {
@@ -375,7 +379,7 @@ static void resetOptions() {
 	sam_print_zp            = false;
 	sam_print_zu            = false;
 	sam_print_zt            = false;
-	preserve_sam_tags       = false;
+	preserve_tags           = false;
 	align_paired_reads      = false;
 	bwaSwLike               = false;
 	gSeedLenIsSet			= false;
@@ -461,6 +465,9 @@ static void resetOptions() {
 	bowtie2p5 = false;
 	logDps.clear();          // log seed-extend dynamic programming problems
 	logDpsOpp.clear();       // log mate-search dynamic programming problems
+#ifdef USE_SRA
+	sra_accs.clear();
+#endif
 }

 static const char *short_options = "bfF:qbzhcu:rv:s:aP:t3:5:w:p:k:M:1:2:I:X:CQ:N:i:L:U:x:S:g:O:D:R:";
@@ -514,7 +521,7 @@ static struct option long_options[] = {
 {(char*)"12",                          required_argument,  0,                   ARG_ONETWO},
 {(char*)"tab5",                        required_argument,  0,                   ARG_TAB5},
 {(char*)"tab6",                        required_argument,  0,                   ARG_TAB6},
-{(char*)"interleaved",                 required_argument,  0,                   ARG_INTERLEAVED_FASTQ},
+{(char*)"interleaved",                 required_argument,  0,                   ARG_INTERLEAVED},
 {(char*)"phred33-quals",               no_argument,        0,                   ARG_PHRED33},
 {(char*)"phred64-quals",               no_argument,        0,                   ARG_PHRED64},
 {(char*)"phred33",                     no_argument,        0,                   ARG_PHRED33},
@@ -652,8 +659,11 @@ static struct option long_options[] = {
 {(char*)"thread-ceiling",              required_argument,  0,                   ARG_THREAD_CEILING},
 {(char*)"thread-piddir",               required_argument,  0,                   ARG_THREAD_PIDDIR},
 {(char*)"trim-to",                     required_argument,  0,                   ARG_TRIM_TO},
-{(char*)"preserve-sam-tags",           no_argument,        0,                   ARG_PRESERVE_SAM_TAGS},
+{(char*)"preserve-tags",               no_argument,        0,                   ARG_PRESERVE_TAGS},
 {(char*)"align-paired-reads",          no_argument,        0,                   ARG_ALIGN_PAIRED_READS},
+#ifdef USE_SRA
+{(char*)"sra-acc",                     required_argument,  0,                   ARG_SRA_ACC},
+#endif
 {(char*)0,                             0,                  0,                   0} //  terminator
 };

@@ -704,7 +714,11 @@ static void printUsage(ostream& out) {
 		tool_name = "bowtie2";
 	}
 	out << "Usage: " << endl
-	    << "  " << tool_name.c_str() << " [options]* -x <bt2-idx> {-1 <m1> -2 <m2> | -U <r> | --interleaved <i>} [-S <sam>]" << endl
+#ifdef USE_SRA
+	    << "  " << tool_name.c_str() << " [options]* -x <bt2-idx> {-1 <m1> -2 <m2> | -U <r> | --interleaved <i> | --sra-acc <acc> | -b <bam>} [-S <sam>]" << endl
+#else
+	    << "  " << tool_name.c_str() << " [options]* -x <bt2-idx> {-1 <m1> -2 <m2> | -U <r> | --interleaved <i> | -b <bam>} [-S <sam>]" << endl
+#endif
 	    << endl
 		<<     "  <bt2-idx>  Index filename prefix (minus trailing .X." + gEbwt_ext + ")." << endl
 		<<     "             NOTE: Bowtie 1 and Bowtie 2 indexes are not compatible." << endl
@@ -720,10 +734,15 @@ static void printUsage(ostream& out) {
 	if(wrapper == "basic-0") {
 		out << "             Could be gzip'ed (extension: .gz) or bzip2'ed (extension: .bz2)." << endl;
 	}
-	out <<     "  <i>        Files with interleaved paired-end FASTQ reads" << endl;
+	out <<     "  <i>        Files with interleaved paired-end FASTQ/FASTA reads" << endl;
 	if(wrapper == "basic-0") {
 		out << "             Could be gzip'ed (extension: .gz) or bzip2'ed (extension: .bz2)." << endl;
 	}
+#ifdef USE_SRA
+	out <<     "  <acc>      Files are SRA accessions. Accessions not found in local storage will\n"
+	    <<     "             be fetched from NCBI." << endl;
+#endif
+	out <<     "  <bam>      Files are unaligned BAM sorted by read name." << endl;
 	out <<     "  <sam>      File for SAM output (default: stdout)" << endl
 	    << endl
 	    << "  <m1>, <m2>, <r> can be comma-separated lists (no whitespace) and can be" << endl
@@ -813,6 +832,12 @@ static void printUsage(ostream& out) {
 	    << "  --no-contain       not concordant when one mate alignment contains other" << endl
 	    << "  --no-overlap       not concordant when mates overlap at all" << endl
 	    << endl
+	    << " BAM:" << endl
+	    << "  --align-paired-reads Bowtie2 will, by default, attempt to align unpaired BAM reads." << endl
+	    << "                     Use this option to align paired-end reads instead." << endl
+	    << "  --preserve-tags    Preserve tags from the original BAM record by" << endl
+	    << "                     appending them to the end of the corresponding SAM output." << endl
+	    << endl
 	    << " Output:" << endl;
 	//if(wrapper == "basic-0") {
 	//	out << "  --bam              output directly to BAM (by piping through 'samtools view')" << endl;
@@ -861,8 +886,7 @@ static void printUsage(ostream& out) {
 	    << "  --non-deterministic seed rand. gen. arbitrarily instead of using read attributes" << endl
 	//  << "  --verbose          verbose output for debugging" << endl
 	    << "  --version          print version information and quit" << endl
-	    << "  -h/--help          print this usage message" << endl
-	    ;
+	    << "  -h/--help          print this usage message" << endl;
 	if(wrapper.empty()) {
 		cerr << endl
 		     << "*** Warning ***" << endl
@@ -961,7 +985,7 @@ static bool saw_trim3;
 static bool saw_trim5;
 static bool saw_trim_to;
 static bool saw_bam;
-static bool saw_preserve_sam_tags;
+static bool saw_preserve_tags;
 static bool saw_align_paired_reads;
 static EList<string> presetList;

@@ -1001,9 +1025,8 @@ static void parseOption(int next_option, const char *arg) {
 		case ARG_ONETWO: tokenize(arg, ",", mates12); format = TAB_MATE5; break;
 		case ARG_TAB5:   tokenize(arg, ",", mates12); format = TAB_MATE5; break;
 		case ARG_TAB6:   tokenize(arg, ",", mates12); format = TAB_MATE6; break;
-		case ARG_INTERLEAVED_FASTQ: {
+		case ARG_INTERLEAVED: {
 			tokenize(arg, ",", mates12);
-			format = FASTQ;
 			interleaved = true;
 			break;
 		}
@@ -1055,9 +1078,9 @@ static void parseOption(int next_option, const char *arg) {
 		case ARG_SEED_SUMM: seedSumm = true; break;
 		case ARG_SC_UNMAPPED: scUnMapped = true; break;
 		case ARG_XEQ: xeq = true; break;
-		case ARG_PRESERVE_SAM_TAGS: {
-			preserve_sam_tags = true;
-			saw_preserve_sam_tags = true;
+		case ARG_PRESERVE_TAGS: {
+			preserve_tags = true;
+			saw_preserve_tags = true;
 			break;
 		}
 		case ARG_ALIGN_PAIRED_READS: {
@@ -1522,6 +1545,13 @@ static void parseOption(int next_option, const char *arg) {
 			}
 			break;
 		}
+#ifdef USE_SRA
+        case ARG_SRA_ACC: {
+            tokenize(arg, ",", sra_accs);
+            format = SRA_FASTA;
+            break;
+        }
+#endif
        case ARG_VERSION: showVersion = 1; break;
 		default:
 			printUsage(cerr);
@@ -1542,7 +1572,7 @@ static void parseOptions(int argc, const char **argv) {
 	saw_trim5 = false;
 	saw_trim_to = false;
 	saw_bam = false;
-	saw_preserve_sam_tags = false;
+	saw_preserve_tags = false;
 	saw_align_paired_reads = false;
 	presetList.clear();
 	if(startVerbose) { cerr << "Parsing options: "; logTime(cerr, true); }
@@ -1574,8 +1604,8 @@ static void parseOptions(int argc, const char **argv) {
 		exit(1);
 	}

-	if (!saw_bam && saw_preserve_sam_tags) {
-		cerr << "--preserve_sam_tag can only be used when aligning BAM reads." << endl;
+	if (!saw_bam && saw_preserve_tags) {
+		cerr << "--preserve_tags can only be used when aligning BAM reads." << endl;
 		exit(1);
 	}

@@ -1649,6 +1679,10 @@ static void parseOptions(int argc, const char **argv) {
 		     << "sequences must be specified with -1 and -2." << endl;
 		throw 1;
 	}
+	if(interleaved && (format != FASTA && format != FASTQ)) {
+		cerr << "Error: --interleaved only works in combination with FASTA (-f) and FASTQ (-q) formats." << endl;
+		throw 1;
+	}
 	if(qualities.size() && format != FASTA) {
 		cerr << "Error: one or more quality files were specified with -Q but -f was not" << endl
 		     << "enabled.  -Q works only in combination with -f and -C." << endl;
@@ -4802,9 +4836,10 @@ static void driver(
 		fastaContLen,  // length of sampled reads for FastaContinuous...
 		fastaContFreq, // frequency of sampled reads for FastaContinuous...
 		skipReads,     // skip the first 'skip' patterns
+		qUpto,         // max number of queries to read
 		nthreads,      //number of threads for locking
 		outType != OUTPUT_SAM, // whether to fix mate names
-		preserve_sam_tags, // keep existing SAM tags when aligning BAM files
+		preserve_tags, // keep existing tags when aligning BAM files
 		align_paired_reads // Align only the paired reads in BAM file
 	);
 	if(gVerbose || startVerbose) {
@@ -4818,6 +4853,9 @@ static void driver(
 		qualities,   // qualities associated with singles
 		qualities1,  // qualities associated with m1
 		qualities2,  // qualities associated with m2
+#ifdef USE_SRA
+		sra_accs,    // SRA accessions
+#endif
 		pp,          // read read-in parameters
 		gVerbose || startVerbose); // be talkative
 	// Open hit output file
@@ -5125,11 +5163,18 @@ int bowtie(int argc, const char **argv) {

 			// Get query filename
 			bool got_reads = !queries.empty() || !mates1.empty() || !mates12.empty();
+#ifdef USE_SRA
+			got_reads = got_reads || !sra_accs.empty();
+#endif
 			if(optind >= argc) {
 				if(!got_reads) {
 					printUsage(cerr);
 					cerr << "***" << endl
+#ifdef USE_SRA
+					     << "Error: Must specify at least one read input with -U/-1/-2/--sra-acc" << endl;
+#else
 					     << "Error: Must specify at least one read input with -U/-1/-2" << endl;
+#endif
 					return 1;
 				}
 			} else if(!got_reads) {

--- a/debian/changelog
+++ b/debian/changelog
-bowtie2 (2.3.4.3-2) UNRELEASED; urgency=medium
+bowtie2 (2.3.5.1-1) UNRELEASED; urgency=medium

-  * Team upload.
+  * Team upload
+
+
+  [ Michael R. Crusoe ]
  * bowtie-examples: set Multi-Arch: foreign
  * Standards-Version: 4.3.0

+  [ Steffen Moeller ]
+  * debhelper-compat 12
+  * Standards-Version: 4.4.0
+  * New upstream version - yet fails to build -> crash
+
 -- Michael R. Crusoe <michael.crusoe@gmail.com>  Mon, 24 Dec 2018 04:19:34 -0800

 bowtie2 (2.3.4.3-1) unstable; urgency=medium

--- a/debian/compat
+++ b/debian/compat
-11
--- a/debian/control
+++ b/debian/control
@@ -4,7 +4,7 @@ Uploaders: Alexandre Mestiashvili <mestia@debian.org>,
           Andreas Tille <tille@debian.org>
 Section: science
 Priority: optional
-Build-Depends: debhelper (>= 11),
+Build-Depends: debhelper-compat (= 12),
               help2man,
               libtbb-dev,
               python,
@@ -12,7 +12,7 @@ Build-Depends: debhelper (>= 11),
               libtest-deep-perl,
               libclone-perl,
               zlib1g-dev
-Standards-Version: 4.3.0
+Standards-Version: 4.4.0
 Vcs-Browser: https://salsa.debian.org/med-team/bowtie2
 Vcs-Git: https://salsa.debian.org/med-team/bowtie2.git
 Homepage: http://bowtie-bio.sourceforge.net/bowtie2