.gitattributes

+ltmain.sh linguist-vendored
\ No newline at end of file

.travis.yml

@@ -6,6 +6,7 @@ addons:
     - check
     - g++
     - libtool
+    - libsubunit-dev
     - pkg-config
     - python3-dev
     - python3-setuptools

CHANGELOG

+v2.3.2 - 12 Jan 2018
+-----
+Update installation instructions to remove all reference to HomeBrew.
+
 v2.3.1 - 22 Sept 2017
 -----
 Output a tree with the internal nodes labelled.

Dockerfile

-#
-#  From this base-image / starting-point
-#
-FROM debian:testing
+# Use a LTS Ubuntu version as parent image
+FROM ubuntu:16.04
+ARG DEBIAN_FRONTEND=noninteractive
+ARG PYTHONWARNINGS="ignore:Unverified HTTPS request"
+ENV LD_LIBRARY_PATH='/usr/local/lib'
+WORKDIR /opt
 
-#
-#  Authorship
-#
-MAINTAINER ap13@sanger.ac.uk
+# Install general dependencies
+RUN apt-get update && apt-get install --no-install-recommends -y \
+	curl \
+	make \
+	automake \
+	gcc \
+	pkg-config \
+	zlib1g-dev \
+	autoconf \
+	check \
+	libtool \
+	libsubunit-dev \
+	git \
+    python3 \
+    python3-dev \
+    python3-setuptools \
+    python3-pip
 
-#
-# Pull in packages from testing
-#
-RUN apt-get update -qq
+# Install python dependencies 
+RUN pip3 install --trusted-host pypi.python.org --upgrade pip
+RUN pip3 install certifi \
+  && pip3 install wheel \
+  && pip3 install nose \
+  && pip3 install pillow \
+  && pip3 install dendropy \
+  && pip3 install biopython
   
-#
-# Install Roary
-#
-RUN apt-get install gubbins
+# Install RAxML
+ARG raxml_version='8.2.12'
+RUN curl -L https://github.com/stamatak/standard-RAxML/archive/v${raxml_version}.tar.gz -o standard-RAxML-${raxml_version}.tar.gz \
+  && tar xzf standard-RAxML-${raxml_version}.tar.gz \
+  && cd standard-RAxML-${raxml_version} \
+  && make -f Makefile.gcc \
+  && make -f Makefile.PTHREADS.gcc \
+  && cp raxmlHPC /usr/local/bin/ \
+  && cp raxmlHPC-PTHREADS /usr/local/bin/ \
+  && cd .. \
+  && rm -rf standard-RAxML-${raxml_version}
+
+# Install FastTree
+ARG fasttree_version='2.1.10'
+RUN curl http://www.microbesonline.org/fasttree/FastTree-${fasttree_version}.c -o FastTree.c \
+  && gcc -O3 -finline-functions -funroll-loops -Wall -o FastTree FastTree.c -lm \
+  && mv FastTree /usr/local/bin/ \
+  && rm FastTree.c
+  
+# Install IQTree
+ARG iqtree_version='1.6.6'
+RUN curl -L https://github.com/Cibiv/IQ-TREE/releases/download/v${iqtree_version}/iqtree-${iqtree_version}-Linux.tar.gz -o iqtree-${iqtree_version}-Linux.tar.gz \
+  && tar xzf iqtree-${iqtree_version}-Linux.tar.gz \
+  && cp iqtree-${iqtree_version}-Linux/bin/iqtree /usr/local/bin \
+  && rm -rf iqtree-${iqtree_version}-Linux
+
+# Install Gubbins
+RUN git clone https://github.com/sanger-pathogens/gubbins.git \
+  && cd gubbins \
+  && autoreconf -i \
+  && ./configure \
+  && make \
+  && make check \
+  && make install \
+  && cd python \
+  && python3 setup.py install
+  
+# Rename executable for backwards compatibility
+RUN mv /usr/local/bin/run_gubbins.py /usr/local/bin/run_gubbins

INSTALL.md

 Before you do anything, please have a look at the [Gubbins webpage](http://sanger-pathogens.github.io/gubbins/).
 
 # Installation
-There are a few ways to install Gubbins and its dependancies. The simpliest way is using HomeBrew (OSX) or LinuxBrew.
+There are a few ways to install Gubbins and its dependencies. The simpliest way is using conda.
 
-* OSX - Mavericks (10.9) & Yosemite (10.10) & El Capitan (10.11)
-* OSX - Mountain Lion (10.8)
-* Linux - Ubuntu Trusty (14.04) & Precise (12.04)
-* Linux - Ubuntu Xenial (16.04) & Debian (unstable)
-* Linux - CentOS 7
-* Linux - CentOS 6
 * OSX/Linux - Bioconda
+* Linux - Ubuntu Xenial (16.04) & Debian (unstable)
+* OSX/Linux/Cloud/Windows - Docker
 * OSX/Linux - from source
 * OSX/Linux/Windows - Virtual Machine
 
+## OSX/Linux - conda
+Install conda and enable the bioconda channels.
 
-## OSX - Mavericks (10.9) & Yosemite (10.10) & El Capitan (10.11)
-Install [HomeBrew](http://brew.sh/). It requires a minimum of Xcode 5.1.1 (xcodebuild -version). Then run:
 ```
-brew tap homebrew/science
-brew install gubbins
+conda config --add channels r
+conda config --add channels defaults
+conda config --add channels conda-forge
+conda config --add channels bioconda
+conda install gubbins
 ```
 
-## OSX - Mountain Lion (10.8)
-Install [HomeBrew](http://brew.sh/). It requires a minimum of Xcode 5.1.1 (xcodebuild -version).
+## Linux - Ubuntu Xenial (16.04) & Debian (unstable)
+Gubbins has been packaged by the Debian Med team and is trivial to install using apt.
 
-Then run:
-```
-brew tap homebrew/science
-brew install python3
-brew install gubbins
-```
+    sudo apt-get install gubbins
 
-## OSX - It failed to install
-* Run 'brew doctor' and correct any errors with your homebrew setup.
-* Make sure Xcode is 5.1.1 or greater (xcodebuild -version). 
-* Install it in /usr/local. Homebrew warn 'Pick another prefix at your peril!'.
-* Run 'brew install -vd gubbins' and try and correct any errors.
+## OSX/Linux/Cloud/Windows - Docker
+We have a docker container which gets automatically built from the latest version of Gubbins in Debian Med. To install it:
 
-## Linux - Ubuntu Trusty (14.04) & Precise (12.04)
-Tested on Ubuntu Trusty (14.04) and Precise (12.04). Install [LinuxBrew](http://brew.sh/linuxbrew/). Then run:
+    docker pull sangerpathogens/gubbins
 
-```
-sudo apt-get install gfortran
-brew tap homebrew/science
-brew install python3
-brew install gubbins
-```
+To use it you would use a command such as this:
 
-## Linux - Ubuntu Xenial (16.04) & Debian (unstable)
-Gubbins has been packaged by the Debian Med team and is trivial to install using apt.
-```
-sudo apt-get install gubbins
-```
+    docker run --rm -it -v <local_dir>:<remote_dir> sangerpathogens/gubbins run_gubbins -p <remote_dir>/<prefix> [<options>] <remote_dir>/<alignment_file>
 
-## Linux - CentOS/RHEL 7
-Enable EPEL and make sure compilers are installed.
-```
-sudo yum install epel-release gcc gcc-c++ automake
-```
-Install [LinuxBrew](http://brew.sh/linuxbrew/).
-```
-brew tap homebrew/science
-brew tap homebrew/dupes	
-ln -s $(which gcc) ~/.linuxbrew/bin/gcc-4.8
-ln -s $(which g++) ~/.linuxbrew/bin/g++-4.8
-ln -s $(which gfortran) ~/.linuxbrew/bin/gfortran-4.8
-brew install ruby gpatch python3
-brew install gubbins
-```
-
-## Linux - CentOS/RHEL 6.6
-Enable EPEL and make sure compilers are installed.
-```
-sudo yum install epel-release gcc gcc-c++ automake ruby-irb
-```
-Install [LinuxBrew](http://brew.sh/linuxbrew/).
-```
-brew tap homebrew/science
-ln -s $(which gcc) ~/.linuxbrew/bin/gcc-4.4
-ln -s $(which g++) ~/.linuxbrew/bin/g++-4.4
-ln -s $(which gfortran) ~/.linuxbrew/bin/gfortran-4.4
-brew install ruby python3
-brew install gubbins
-```
+The flag `-v` synchronizes a directory on the host machine (here denoted as `<local_dir>`) with a directory in the Docker container (here denoted as `<remote_dir>`).
+`<remote_dir>` does not need to exist in the container before the run, a common choice is `/data`.
+Note that both `<local_dir>` and `<remote_dir>` must be absolute paths.
 
-## OSX/Linux - Bioconda
-Install conda and enable the bioconda channels.
+The input alignment file must be present in `<local_dir>` (or in one of its subdirectories).
+In order to retrieve the files produced by Gubbins, run the program with option `-p`; 
+the argument of this option must consist of `<remote_dir>`, followed by an arbitrary identifier (here denoted as `<prefix>`).
 
-```
-conda install gubbins
-```
 
 ## OSX/Linux - from source
-This is the most difficult method and is only suitable for someone with advanced computing skills. Please consider using HomeBrew/LinuxBrew instead.
+This is the most difficult method and is only suitable for someone with advanced computing skills. Please consider using Conda instead.
 
-Install the dependances and include them in your PATH:
+Install the dependencies and include them in your `PATH`:
 * [FastTree](http://www.microbesonline.org/fasttree/#Install) ( >=2.1.4 )
 * [RAxML](https://github.com/stamatak/standard-RAxML) ( >=8.0 )
 * Python modules: Biopython (> 1.59), DendroPy (>=4.0), Reportlab, nose, pillow
 * Standard build environment tools (e.g. python3, pip3, make, autoconf, libtool, gcc, check, etc...)
 
+Clone or download the source code from GitHub and run the following commands to install Gubbins:
 ```
 autoreconf -i
-./configure
+./configure [--prefix=$PREFIX]
 make
-sudo make install
+[sudo] make install
 cd python
-sudo python3 setup.py install
+[sudo] python3 setup.py install
 ```
+Use `sudo` to install Gubbins system-wide. If you don't have the permissions, run `configure` with a prefix to install Gubbins in your home directory.
 
 ## OSX/Linux/Windows - Virtual Machine
-Roary wont run natively on Windows but we have created virtual machine which has all of the software setup, along with the test datasets from the paper. 
+Roary wont run natively on Windows but we have created a virtual machine which has all of the software setup, along with the test datasets from the paper. 
 It is based on [Bio-Linux 8](http://environmentalomics.org/bio-linux/).  You need to first install [VirtualBox](https://www.virtualbox.org/), 
 then load the virtual machine, using the 'File -> Import Appliance' menu option. The root password is 'manager'.
 

README.md

@@ -13,7 +13,7 @@ Since the introduction of high-throughput, second-generation DNA sequencing tech
 
 Install
 =======
-Please see the INSTALL file for detailed instructions.
+Please see the [INSTALL](INSTALL.md) file for detailed instructions.
 
 Running Gubbins
 ===============
@@ -128,6 +128,11 @@ Phylip format alignment of filtered polymorphic sites used to generate the phylo
 
 Final phylogenetic tree in newick format.
 
+    .node_labelled.final_tree.tre
+    
+Final phylogenetic tree in newick format but with internal node labels.
+
+
 
 
 Data from the paper
@@ -139,7 +144,7 @@ Midpoint rerooting
 ==================
 From version 1.3.5 (25/6/15) to version 1.4.6 (29/2/16) trees were not midpoint rerooted by default. This doesnt have any effect on the recombination detection, but the output trees may not look as expected. Users are advised to upgrade to the latest version.
 
-Ancestoral sequence reconstruction
+Ancestral sequence reconstruction
 ==================
 From version 2.0.0 onwards, RAxML is used to reconstruction ancestral sequences instead of fastML. RAxML doesnt always produce results as you would expect so the results can be lower quaility than fastML. If you would like to stick with fastML for ancestral sequence reconstruction, please checkout and install v1.4.9.
 

VERSION

-2.3.1
+2.3.4

debian/changelog

+gubbins (2.3.4-1) unstable; urgency=medium
+
+  * New upstream version
+  * debhelper 11
+  * Point Vcs fields to salsa.debian.org
+  * Standards-Version: 4.2.1
+  * debian/rules:
+     - Respect DEB_BUILD_OPTIONS in override_dh_auto_test
+     - Do not parse d/changelog
+  * Remove unneeded Testsuite: autopkgtest
+
+ -- Andreas Tille <tille@debian.org>  Wed, 26 Sep 2018 16:48:49 +0200
+
 gubbins (2.3.1-1) unstable; urgency=medium
 
   * Team upload.

debian/compat

-9
+11

debian/control

@@ -4,12 +4,10 @@ Uploaders: Andreas Tille <tille@debian.org>,
            Aidan Delaney <a.j.delaney@brighton.ac.uk>
 Section: science
 Priority: optional
-Build-Depends: debhelper (>= 9),
-               dh-autoreconf,
+Build-Depends: debhelper (>= 11~),
                dh-python,
                fasttree,
                raxml (>= 8),
-               autotools-dev,
                python3-setuptools,
                zlib1g-dev,
                check,
@@ -19,10 +17,9 @@ Build-Depends: debhelper (>= 9),
                python3-reportlab,
                python3-nose,
                pkg-config
-Standards-Version: 4.0.0
-Testsuite: autopkgtest
-Vcs-Browser: https://anonscm.debian.org/cgit/debian-med/gubbins.git
-Vcs-Git: https://anonscm.debian.org/git/debian-med/gubbins.git
+Standards-Version: 4.2.1
+Vcs-Browser: https://salsa.debian.org/med-team/gubbins
+Vcs-Git: https://salsa.debian.org/med-team/gubbins.git
 Homepage: https://sanger-pathogens.github.io/gubbins/
 
 Package: gubbins

debian/patches/add_missing_lib_for_check.patch

-Author: Andreas Tille <tille@debian.org>
-Last-Update: Thu, 19 Nov 2015 10:45:48 +0100
-Description: Current gcc needs explict -lsubunit to find this library
-
---- a/src/Makefile.am
-+++ b/src/Makefile.am
-@@ -33,5 +33,5 @@ run_all_tests_CFLAGS = -I../tests $(PTHR
- run_all_tests_LDADD = -lcheck libgubbins.la -lz -lm $(PTHREAD_LDFLAGS)
- 
- if HOST_LINUX
--run_all_tests_LDADD += -lrt
-+run_all_tests_LDADD += -lrt -lsubunit
- endif

debian/patches/disable_test.patch

@@ -4,7 +4,7 @@ Author: Sascha Steinbiss <satta@debian.org>
 Forwarded: https://github.com/sanger-pathogens/gubbins/issues/177
 --- a/python/gubbins/tests/test_external_dependancies.py
 +++ b/python/gubbins/tests/test_external_dependancies.py
-@@ -25,7 +25,7 @@
+@@ -25,7 +25,7 @@ class TestExternalDependancies(unittest.
      assert re.match('.*/ls$', common.GubbinsCommon.which('ls -alrt')) != None
      assert common.GubbinsCommon.which('non_existant_program') == None
      
@@ -13,7 +13,7 @@ Forwarded: https://github.com/sanger-pathogens/gubbins/issues/177
      parser = self.base_arg_parse()
      parser.add_argument('--min_window_size',  '-a', help='Minimum window size, default 100', type=int,  default = 80)
      parser.add_argument('--max_window_size',  '-b', help='Maximum window size, default 10000', type=int,  default = 1000)
-@@ -72,7 +72,7 @@
+@@ -74,7 +74,7 @@ class TestExternalDependancies(unittest.
      self.cleanup()
         
         

debian/patches/series

-add_missing_lib_for_check.patch
 do_not_handle_python_by_upstream_build_system.patch
 gubbins_exe_in_usr_lib.patch
 disable_test.patch

debian/rules

@@ -3,7 +3,7 @@
 # Uncomment this to turn on verbose mode.
 #export DH_VERBOSE=1
 
-DEBPKGNAME     := $(shell dpkg-parsechangelog | awk '/^Source:/ {print $$2}')
+include /usr/share/dpkg/default.mk
 
 # Fails to build with the following settings
 # export DEB_BUILD_MAINT_OPTIONS = hardening=+all
@@ -11,7 +11,7 @@ DEBPKGNAME     := $(shell dpkg-parsechangelog | awk '/^Source:/ {print $$2}')
 export DEB_BUILD_MAINT_OPTIONS = hardening=+bindnow
 
 %:
-	dh $@  --with autoreconf --with python3
+	dh $@ --with python3
 
 override_dh_auto_install:
 	dh_auto_install
@@ -20,16 +20,18 @@ override_dh_auto_install:
 	python3 setup.py install --root=../debian/gubbins --install-layout=deb --install-lib=/usr/share/gubbins --install-scripts=/usr/share/gubbins
 
 override_dh_auto_test:
+ifeq (,$(filter nocheck,$(DEB_BUILD_OPTIONS)))
 	dh_auto_test
 	cd python && \
 	python3 setup.py test
+endif
 
 override_dh_install:
 	dh_install
 	find debian -name "*.la" -delete
 	find debian -name "*.a" -delete
-	mkdir -p debian/$(DEBPKGNAME)/usr/lib/$(DEBPKGNAME)
-	mv debian/$(DEBPKGNAME)/usr/bin/gubbins debian/$(DEBPKGNAME)/usr/lib/$(DEBPKGNAME)
+	mkdir -p debian/$(DEB_SOURCE)/usr/lib/$(DEB_SOURCE)
+	mv debian/$(DEB_SOURCE)/usr/bin/gubbins debian/$(DEB_SOURCE)/usr/lib/$(DEB_SOURCE)
 
 override_dh_clean:
 	dh_clean

example_data/PMEN1/PMEN1.filtered_polymorphic_sites.fasta

+>2682
+GCCTTTCCGTCTTGCGGCCGCGTAGCCACACCCGCCGCCCCGCTGCCCTTAGACCCAGGGACATGGGGA-CACCTAGACTCCGGGGTGTGTTCAGGGCTTGGGCGGCA--GGATAATATCACGGCTACTAAGGT
+>1731
+GC-TCTCCGTTTTGCGGCCGCGTAGCCATGCCCGCTGCCTCGCTGCCCTCGGGCCCGGGGACGTGGGGACCACTCAGGCTCCGGGGTGTGCTCAAGGCCGGGGCG-CAC-GGATAACATCGCGGCTGCTGAGGT
+>1788
+GCTTCTCCGTCT-GCGACCACGCAGCCACGCTCGCTACCCCACTGCTCACGGGCCCGGGGA-ATGGGGA-CGTTCAGGCTCCGGGGTGTGTTCAGGGTC-GGATATTATAGGTTAAC-TCGCGGCTGCTGACAT
+>3350
+GCTTCTCCGTCTCGTGACTGCGTAGTCACGCCCGCTACCCCATAGCCCTCGGGCCAGGGGTCATGGGGATCGCTCAGGCCCCGGGGTGCTTGCAGAGCCTGGATATTATACGATAACATCGTGATTGCTGAGGT
+>3355
+GCTTCTCCG-CT-GTG-CTGCGTAGTCACGCCCGCTACCCCATAGCCCTCGGGCCA-GGG--AT-GGGA-CGCTCAGGCCCCGGGGTG--TGCA-AGCCTGGATATTATACGACCAC-TCGTGG-TGCTGAGGT
+>1842
+GCTTCTTCGTTT-ATGACCGCGTAGCCGCGTCCGCTACCCCACAGCCCTCGGGCCCGGGGT-ATGGGGA-CGCTCAGGCCCCGGGGTGTGTGAAGAGCCTGGATATTATAGGATAACATCGCGGTTGCTGAGGT
+>2097
+GCTTCTCCGTCTCGCGACCGCGTAACTACGCCCGCTACCCCACTGCCCTCGGGCCCGGGGACATGGGGA-CGCTCAAGTTCCGGGGGGTGTTCAGGGCCTGGATATTATCGGATAACATCGCGGCTGCTGTGGA
+>2098
+GTTTCTCCGTCNCGCGAT-GCTTGGCCACGCCCATTACCCCACTGACCTCGGGCCCGAGGACACTGGGACCGCTCGGGCTCTGGGGTATGTTCAGGACCTAGATATTATAGAATAGCATCGCGGCCGCTGAGGT
+>1789
+GCTTCTCCTG-C-GCGAC-GTGTAGCCACGCCCGCTAGCCCACTACCCTCGAGCTCGGAG--ATGGAGG-TGCTCAGGCTCCGGGGTGTGTTCGGGACCTGGATATTATAGGATAACATTGCGGCTGCTGAGGT
+>2699
+TCTTCACTGTCTCGCGACCGCGTAGCCACGCCAGCTGCCCCGCTGCCCTCGGGCCCGGGGATATGTGGA-CACTCAGGCTCCGAGATGTGTTCAGGGCCTGGATATTTTAGGATAACATCGCGGCTGCTGAGGT
+>3267
+GCTGCACTGTCNCGCAACCGCGTAGCCACGCCAGCTGCTCTGCTGCCTTCGGGTCCGGGAATATGGGTACCACTCAGGCTTCTAAATGTGTTCAGGGCCTGAATATTATAGGATAACGCCGCAGCTGAGGAGGT

example_data/PMEN1/PMEN1.filtered_polymorphic_sites.phylip

+11 134
+2682	GCCTTTCCGTCTTGCGGCCGCGTAGCCACACCCGCCGCCCCGCTGCCCTTAGACCCAGGGACATGGGGA-CACCTAGACTCCGGGGTGTGTTCAGGGCTTGGGCGGCA--GGATAATATCACGGCTACTAAGGT
+1731	GC-TCTCCGTTTTGCGGCCGCGTAGCCATGCCCGCTGCCTCGCTGCCCTCGGGCCCGGGGACGTGGGGACCACTCAGGCTCCGGGGTGTGCTCAAGGCCGGGGCG-CAC-GGATAACATCGCGGCTGCTGAGGT
+1788	GCTTCTCCGTCT-GCGACCACGCAGCCACGCTCGCTACCCCACTGCTCACGGGCCCGGGGA-ATGGGGA-CGTTCAGGCTCCGGGGTGTGTTCAGGGTC-GGATATTATAGGTTAAC-TCGCGGCTGCTGACAT
+3350	GCTTCTCCGTCTCGTGACTGCGTAGTCACGCCCGCTACCCCATAGCCCTCGGGCCAGGGGTCATGGGGATCGCTCAGGCCCCGGGGTGCTTGCAGAGCCTGGATATTATACGATAACATCGTGATTGCTGAGGT
+3355	GCTTCTCCG-CT-GTG-CTGCGTAGTCACGCCCGCTACCCCATAGCCCTCGGGCCA-GGG--AT-GGGA-CGCTCAGGCCCCGGGGTG--TGCA-AGCCTGGATATTATACGACCAC-TCGTGG-TGCTGAGGT
+1842	GCTTCTTCGTTT-ATGACCGCGTAGCCGCGTCCGCTACCCCACAGCCCTCGGGCCCGGGGT-ATGGGGA-CGCTCAGGCCCCGGGGTGTGTGAAGAGCCTGGATATTATAGGATAACATCGCGGTTGCTGAGGT
+2097	GCTTCTCCGTCTCGCGACCGCGTAACTACGCCCGCTACCCCACTGCCCTCGGGCCCGGGGACATGGGGA-CGCTCAAGTTCCGGGGGGTGTTCAGGGCCTGGATATTATCGGATAACATCGCGGCTGCTGTGGA
+2098	GTTTCTCCGTCNCGCGAT-GCTTGGCCACGCCCATTACCCCACTGACCTCGGGCCCGAGGACACTGGGACCGCTCGGGCTCTGGGGTATGTTCAGGACCTAGATATTATAGAATAGCATCGCGGCCGCTGAGGT
+1789	GCTTCTCCTG-C-GCGAC-GTGTAGCCACGCCCGCTAGCCCACTACCCTCGAGCTCGGAG--ATGGAGG-TGCTCAGGCTCCGGGGTGTGTTCGGGACCTGGATATTATAGGATAACATTGCGGCTGCTGAGGT
+2699	TCTTCACTGTCTCGCGACCGCGTAGCCACGCCAGCTGCCCCGCTGCCCTCGGGCCCGGGGATATGTGGA-CACTCAGGCTCCGAGATGTGTTCAGGGCCTGGATATTTTAGGATAACATCGCGGCTGCTGAGGT
+3267	GCTGCACTGTCNCGCAACCGCGTAGCCACGCCAGCTGCTCTGCTGCCTTCGGGTCCGGGAATATGGGTACCACTCAGGCTTCTAAATGTGTTCAGGGCCTGAATATTATAGGATAACGCCGCAGCTGAGGAGGT

example_data/PMEN1/PMEN1.final_tree.tre

+(((3267:19.258347,2699:3.259416):6.964382,((2097:8.768424,(1842:6.423692,(3355:2.416422,3350:1.166202):9.770878):8.51369):0.000134,((1789:17.896101,2098:20.679014):0.000134,1788:11.717898):0.000134):2.932858):8.745108,2682:20.63868,1731:9.347571):0.0;

example_data/PMEN1/PMEN1.node_labelled.tre

+(((3267:0.143719,2699:0.024324)N3:0.051973,((2097:0.065436,(1842:0.047938,(3355:0.018033,3350:0.008703)N7:0.072917)N6:0.063535)N5:0.000001,((1789:0.133553,2098:0.154321)N9:0.000001,1788:0.087447)N8:0.000001)N4:0.021887)N2:0.065262,2682:0.154020,1731:0.069758)N1;