.travis.yml

@@ -15,17 +15,21 @@ addons:
     packages:
       clang
 
+# NOTE: Currently I commented out testing of python binding on OSX because they do not support
+# Python building and I have to provide the tools myself. I could probably install correct pip
+# (and maybe python) version myself (homebrew?), however I haven't gotten to that yet.
+
 install:
   - if [ $TRAVIS_OS_NAME == "linux" ]; then sudo apt-get install valgrind; fi
-  - sudo -H pip install cython  # Needed to build Python module.
+  - if [ $TRAVIS_OS_NAME == "linux" ]; then sudo -H pip install cython; fi  # Needed to build Python module.
 
 before_script:
   # Build C/C++ library and apps.
   - mkdir -p build && cd build && cmake .. && make && cd ..
 
   # Build Python source distribution and install Edlib from it.
-  - cd bindings/python && make sdist && cd ../..
-  - sudo -H pip install bindings/python/dist/edlib*.tar.gz
+  - if [ $TRAVIS_OS_NAME == "linux" ]; then cd bindings/python && make sdist && cd ../..; fi
+  - if [ $TRAVIS_OS_NAME == "linux" ]; then sudo -H pip install bindings/python/dist/edlib*.tar.gz; fi
 
 script:
   # Test C/C++ library.
@@ -37,4 +41,4 @@ script:
   - if [ $TRAVIS_OS_NAME == "linux" ]; then valgrind --quiet --error-exitcode=2 --tool=memcheck --leak-check=full build/bin/runTests 2; fi
 
   # Test Python module.
-  - sudo -H python bindings/python/test.py
+  - if [ $TRAVIS_OS_NAME == "linux" ]; then sudo -H python bindings/python/test.py; fi

Dockerfile

+FROM alpine
+
+MAINTAINER Martin Sosic <sosic.martin@gmail.com>
+
+WORKDIR ~
+
+# Install needed packages to compile Edlib, then pull it from git repo, compile it,
+# move edlib-aligner to bin/ so it can be executed, delete edlib source files and delete all packages
+# except for libstdc++ (which is needed for edlib-aligner to run) and bash for convenience, in order to keep docker image small.
+RUN apk --no-cache add cmake clang clang-dev make gcc g++ libc-dev linux-headers git libstdc++ bash && \
+    git clone -b v1.2.3 https://github.com/Martinsos/edlib.git edlib-git && \
+    cd edlib-git && cd build && cmake -D CMAKE_BUILD_TYPE=Release .. && make edlib-aligner && \
+    cp bin/edlib-aligner /bin && \
+    cd ../.. && rm -r edlib-git && \
+    apk del cmake clang clang-dev make gcc g++ libc-dev linux-headers git
+
+CMD ["edlib-aligner"]

README.md

 Edlib
-=====
+·
 [![Latest Github release](https://img.shields.io/github/release/Martinsos/edlib.svg)](https://github.com/Martinsos/edlib/releases/latest)
 [![Build status of the master branch on Linux/OSX](https://img.shields.io/travis/Martinsos/edlib/master.svg?label=Linux%20%2F%20OSX%20build)](https://travis-ci.org/Martinsos/edlib)
 [![Build status of the master branch on Windows](https://img.shields.io/appveyor/ci/Martinsos/edlib.svg?label=Windows%20build)](https://ci.appveyor.com/project/Martinsos/edlib/branch/master)
 [![Chat on Gitter](https://img.shields.io/gitter/room/Martinsos/edlib.svg?colorB=753a88)](https://gitter.im/Martinsos/edlib)
 [![Published in Bioinformatics](https://img.shields.io/badge/Published%20in-Bioinformatics-167DA4.svg)](https://doi.org/10.1093/bioinformatics/btw753)
+=====
 
 A lightweight and super fast C/C++ library for sequence alignment using [edit distance](https://en.wikipedia.org/wiki/Edit_distance).
 

apps/aligner/aligner.cpp

@@ -39,13 +39,14 @@ int main(int argc, char * const argv[]) {
     bool findStartLocations = false;
     int option;
     int kArg = -1;
+    int numRepeats = 1;
 
     // If "STD" or "EXT", cigar string will be printed. if "NICE" nice representation
     // of alignment will be printed.
     char alignmentFormat[16] = "NICE";
 
     bool invalidOption = false;
-    while ((option = getopt(argc, argv, "m:n:k:f:spl")) >= 0) {
+    while ((option = getopt(argc, argv, "m:n:k:f:r:spl")) >= 0) {
         switch (option) {
         case 'm': strcpy(mode, optarg); break;
         case 'n': numBestSeqs = atoi(optarg); break;
@@ -54,6 +55,7 @@ int main(int argc, char * const argv[]) {
         case 's': silent = true; break;
         case 'p': findAlignment = true; break;
         case 'l': findStartLocations = true; break;
+        case 'r': numRepeats = atoi(optarg); break;
         default: invalidOption = true;
         }
     }
@@ -77,6 +79,9 @@ int main(int argc, char * const argv[]) {
         fprintf(stderr, "\t-f NICE|CIG_STD|CIG_EXT  Format that will be used to print alignment path,"
                 " can be used only with -p. NICE will give visually attractive format, CIG_STD will "
                 " give standard cigar format and CIG_EXT will give extended cigar format. [default: NICE]\n");
+        fprintf(stderr, "\t-r N  Core part of calculation will be repeated N times."
+                " This is useful only for performance measurement, when single execution is too short to measure."
+                " [default: 1]\n");
         return 1;
     }
     //-------------------------------------------------------------------------//
@@ -157,9 +162,15 @@ int main(int argc, char * const argv[]) {
     for (int i = 0; i < numQueries; i++) {
         char* query = (*querySequences)[i].data();
         int queryLength = (*querySequences)[i].size();
+
         // Calculate score
-        EdlibAlignResult result = edlibAlign(query, queryLength, target, targetLength,
+        EdlibAlignResult result;
+        for (int rep = 0; rep < numRepeats; rep++) {  // Redundant repetition, for performance measurements.
+            result = edlibAlign(query, queryLength, target, targetLength,
                                 edlibNewAlignConfig(k, modeCode, alignTask, NULL, 0));
+            if (rep < numRepeats - 1) edlibFreeAlignResult(result);
+        }
+
         scores[i] = result.editDistance;
         endLocations[i] = result.endLocations;
         startLocations[i] = result.startLocations;

bindings/python/cedlib.pxd

-cdef extern from "edlib.h":
+cdef extern from "edlib.h" nogil:
 
      ctypedef enum EdlibAlignMode: EDLIB_MODE_NW, EDLIB_MODE_SHW, EDLIB_MODE_HW
      ctypedef enum EdlibAlignTask: EDLIB_TASK_DISTANCE, EDLIB_TASK_LOC, EDLIB_TASK_PATH

bindings/python/edlib.pyx

 cimport cython
-from libc.stdlib cimport malloc, free
+from cpython.mem cimport PyMem_Malloc, PyMem_Free
 
 cimport cedlib
 
 def align(query, target, mode="NW", task="distance", k=-1, additionalEqualities=None):
     """ Align query with target using edit distance.
-    @param {string} query
-    @param {string} target
+    @param {string or bytes array} query
+    @param {string or bytes array} target
     @param {string} mode  Optional. Alignment method do be used. Possible values are:
             - 'NW' for global (default)
             - 'HW' for infix
@@ -35,9 +35,9 @@ def align(query, target, mode="NW", task="distance", k=-1, additionalEqualities=
                 e.g. cigar of "5=1X1=1I" means "5 matches, 1 mismatch, 1 match, 1 insertion (to target)".
     """
     # Transform python strings into c strings.
-    cdef bytes query_bytes = query.encode();
+    cdef bytes query_bytes = query.encode('utf-8') if type(query) != bytes else query;
     cdef char* cquery = query_bytes;
-    cdef bytes target_bytes = target.encode();
+    cdef bytes target_bytes = target.encode('utf-8') if type(target) != bytes else target;
     cdef char* ctarget = target_bytes;
 
     # Build an edlib config object based on given parameters.
@@ -59,21 +59,19 @@ def align(query, target, mode="NW", task="distance", k=-1, additionalEqualities=
         cconfig.additionalEqualities = NULL
         cconfig.additionalEqualitiesLength = 0
     else:
-        cconfig.additionalEqualities = <cedlib.EdlibEqualityPair*> malloc(len(additionalEqualities)
+        cconfig.additionalEqualities = <cedlib.EdlibEqualityPair*> PyMem_Malloc(len(additionalEqualities)
                                                                           * cython.sizeof(cedlib.EdlibEqualityPair))
         for i in range(len(additionalEqualities)):
-            # TODO(martin): Is there a better way to do this conversion? There must be.
-            tmp_bytes = additionalEqualities[i][0].encode();
-            tmp_cstring = tmp_bytes;
-            cconfig.additionalEqualities[i].first = tmp_cstring[0]
-            tmp_bytes = additionalEqualities[i][1].encode();
-            tmp_cstring = tmp_bytes;
-            cconfig.additionalEqualities[i].second = tmp_cstring[0]
+            cconfig.additionalEqualities[i].first = bytearray(additionalEqualities[i][0].encode('utf-8'))[0]
+            cconfig.additionalEqualities[i].second = bytearray(additionalEqualities[i][1].encode('utf-8'))[0]
         cconfig.additionalEqualitiesLength = len(additionalEqualities)
 
-    # Run alignment.
-    cresult = cedlib.edlibAlign(cquery, len(query), ctarget, len(target), cconfig)
-    if cconfig.additionalEqualities != NULL: free(cconfig.additionalEqualities)
+    # Run alignment -- need to get len before disabling the GIL
+    query_len = len(query)
+    target_len = len(target)
+    with nogil:
+        cresult = cedlib.edlibAlign(cquery, query_len, ctarget, target_len, cconfig)
+    if cconfig.additionalEqualities != NULL: PyMem_Free(cconfig.additionalEqualities)
 
     if cresult.status == 1:
         raise Exception("There was an error.")

bindings/python/setup.py

@@ -27,7 +27,7 @@ setup(
     name = "edlib",
     description = "Lightweight, super fast library for sequence alignment using edit (Levenshtein) distance.",
     long_description = long_description,
-    version = "1.2.2",
+    version = "1.2.3-1",
     url = "https://github.com/Martinsos/edlib",
     author = "Martin Sosic",
     author_email = "sosic.martin@gmail.com",

bindings/python/test.py

@@ -7,6 +7,10 @@ result = edlib.align("telephone", "elephant")
 if not (result and result["editDistance"] == 3):
     testFailed = True
 
+result = edlib.align(b"telephone", b"elephant")
+if not (result and result["editDistance"] == 3):
+    testFailed = True
+
 result = edlib.align("ACTG", "CACTRT", mode="HW", task="path", additionalEqualities=[("R", "A"), ("R", "G")])
 if not (result and result["editDistance"] == 0):
     testFailed = True

debian/changelog

+libedlib (1.2.4-1) unstable; urgency=medium
+
+  * New upstream version
+  * debhelper 12
+  * Standards-Version: 4.3.0
+
+ -- Andreas Tille <tille@debian.org>  Mon, 28 Jan 2019 19:11:07 +0100
+
 libedlib (1.2.3-5) unstable; urgency=medium
 
   * Declare characters signed explicitly

debian/compat

-11
+12

debian/control

@@ -3,7 +3,7 @@ Maintainer: Debian Med Packaging Team <debian-med-packaging@lists.alioth.debian.
 Uploaders: Andreas Tille <tille@debian.org>
 Section: science
 Priority: optional
-Build-Depends: debhelper (>= 11~),
+Build-Depends: debhelper (>= 12~),
                cmake,
                dh-python,
                d-shlibs,
@@ -11,7 +11,7 @@ Build-Depends: debhelper (>= 11~),
                cython3,
                python3-all-dev,
                python3-setuptools
-Standards-Version: 4.2.1
+Standards-Version: 4.3.0
 Vcs-Browser: https://salsa.debian.org/med-team/libedlib
 Vcs-Git: https://salsa.debian.org/med-team/libedlib.git
 Homepage: https://github.com/Martinsos/edlib

debian/patches/series

 soversion.patch
 do_not_build_hello_example.patch
 cython3.patch
-signed_char.patch
+# signed_char.patch

test/runTests.cpp

@@ -2,6 +2,7 @@
 #include <ctime>
 #include <cstdlib>
 #include <cstring>
+#include <climits>
 
 #include "edlib.h"
 #include "SimpleEditDistance.h"
@@ -412,8 +413,10 @@ bool test10() {
 bool test11() {
     int queryLength = 8;
     int targetLength = 8;
-    char query[8] =  {-127, 127, -55, 0, 42, 0,      127, -55};
-    char target[8] = {-127, 127,      0, 42, 0, -55, 127,  42};
+    // NOTE(Martin): I am using CHAR_MIN and CHAR_MAX because 'char' type is not guaranteed to be
+    //   signed or unsigned by compiler, we can't know if it is signed or unsigned.
+    char query[8] =  {CHAR_MIN, CHAR_MIN + (CHAR_MAX - CHAR_MIN) / 2, CHAR_MAX};
+    char target[8] = {CHAR_MIN, CHAR_MIN + (CHAR_MAX - CHAR_MIN) / 2 + 1, CHAR_MAX};
 
     bool r = executeTest(query, queryLength, target, targetLength, EDLIB_MODE_HW);
     r = r && executeTest(query, queryLength, target, targetLength, EDLIB_MODE_NW);

test_data/E_coli_DH1/mason_illumina_reads/100bp/e_coli_DH1_illumina_1x100.fasta

+>e_coli_DH1_illumina_1x100.fasta.000000000
+CGTAATAAGGTTCATTGAGCGCAAATGGTGACGTCTTAATAAACGTGGAGATAAACCGACAATATTGATGCTCGCTGCGAAGTTTTTCCGCCGCCCGGGC

test_data/E_coli_DH1/mason_illumina_reads/100bp/mutated_60_perc.fasta

+>e_coli_DH1_illumina_1x100.fasta.000000000
+CGTGATATGGTACCATAATGCGCATCGCTGCGCTTGGTGTCCTGGTAGCGTGGAATAACCGAAGTATGGACCGTTTGCTG
+CCGAAATCTTCCCTCGCGTC

test_data/E_coli_DH1/mason_illumina_reads/100bp/mutated_70_perc.fasta

+>e_coli_DH1_illumina_1x10000.fasta.000000000
+TGTAATGAGATTGATCGAGCGGAAATAGGTACTGTCTTAATAAACATGGAGATACGACGATGTTAGATCACTCGCTGCGA
+TCTTATCCGCCGCCCGGGCA

test_data/E_coli_DH1/mason_illumina_reads/100bp/mutated_80_perc.fasta

+>e_coli_DH1_illumina_1x10000.fasta.000000000
+CGCAGTCATTCAATTGGCGCAAATGGTGACTCTTAACATAAACTGGTGAAGATAACCGACAACATTATGGCTCGCATGCG
+AAGTTGTTACCGGGCATGCA

test_data/E_coli_DH1/mason_illumina_reads/100bp/mutated_90_perc.fasta

+>e_coli_DH1_illumina_1x10000.fasta.000000000
+CGTAATAAGGTTCATAGCGCAAATGGTGACGTCTTAATAAACGTGGAGATAAACCGACAATATCTTGATGCCGCGCGAAG
+TTTTTCCGCCGCCCGGGCAG

test_data/E_coli_DH1/mason_illumina_reads/100bp/mutated_94_perc.fasta

+>e_coli_DH1_illumina_1x10000.fasta.000000000
+CGTAATAAGGTTCACTGAGAGCAAATGGTGACTCTTAATAAAGCGTGGAGATAAGCCGACAATATTGATGCTCGCTCGAA
+GTTTTTCCGCTGCCCGGGCA

test_data/E_coli_DH1/mason_illumina_reads/100bp/mutated_97_perc.fasta

+>e_coli_DH1_illumina_1x10000.fasta.000000000
+CGTAATAAGGTTCATTGAGCGCAAATGGTGACGTCTTATAAGTGGAGATAAACCGACAATATTGATGCTCGCTGCGAAGT
+TTTTCCGCCGCCCGGGCAGC