.gitmodules

@@ -3,8 +3,8 @@
 	url = https://github.com/jwalabroad/fermi-lite
 [submodule "htslib"]
 	path = htslib
-	url = https://github.com/walaj/htslib
-        branch = develop
+	url = https://github.com/samtools/htslib
+        branch = master
 [submodule "bwa"]
 	path = bwa
 	url = https://github.com/jwalabroad/bwa

.travis.scripts/coveralls.sh

@@ -19,7 +19,7 @@ then
     ## download the test data
     mkdir test_data
     cd test_data
-    wget -r -nH -nd -np -R index.html* https://data.broadinstitute.org/snowman/SeqLibTest/
+    wget -r -nH -nd -np -R index.html* https://data.broadinstitute.org/snowman/SeqLib/
     cd ..
     
     export LD_LIBRARY_PATH=${BOOST_ROOT}/lib:${LD_LIBRARY_PATH}

Makefile.in

@@ -285,7 +285,6 @@ pdfdir = @pdfdir@
 prefix = @prefix@
 program_transform_name = @program_transform_name@
 psdir = @psdir@
-runstatedir = @runstatedir@
 sbindir = @sbindir@
 sharedstatedir = @sharedstatedir@
 srcdir = @srcdir@

README.md

@@ -9,6 +9,13 @@ API Documentation
 -----------------
 [API Documentation][htmldoc]
 
+Citation
+--------
+If you use SeqLib in your applications, please cite: http://bioinformatics.oxfordjournals.org/content/early/2016/12/21/bioinformatics.btw741.full.pdf+html
+
+Note that the values for the SeqAn benchmarking in Table 2 should be corrected to 7.7 Gb memory and 33.92 seconds in CPU time, when compiling SeqAn with ``-O3 -DNDEBUG``. SeqAn also does full string decompression.
+Wall times for SeqAn may be shorter than CPU time because it uses embedded multi-threading during BAM IO.
+
 Table of contents
 =================
 
@@ -51,7 +58,7 @@ C_INCLUDE_PATH=$C_INCLUDE_PATH:$SEQ:$SEQ/htslib
 And need to link the SeqLib static library and Fermi, BWA and HTSlib libraries
 ```bash
 SEQ=<path_to_seqlib>
-LDFLAGS="$LDFLAGS -L$SEQ/bin/libseqlib.a -L$SEQ/bin/libbwa.a -L$SEQ/bin/libfml.a -L$SEQ/bin/libhts.a"
+LDFLAGS="$LDFLAGS $SEQ/bin/libseqlib.a $SEQ/bin/libbwa.a $SEQ/bin/libfml.a $SEQ/bin/libhts.a"
 ```
 
 To add support for reading BAMs, etc with HTTPS, FTP, S3, Google cloud, etc, you must compile and link with libcurl.
@@ -101,13 +108,14 @@ provide excellent and high quality APIs. SeqLib provides further performance enh
 bioinformatics problems.
 
 Some differences:
-* SeqLib has ~2-4x faster read/write speed over BamTools and SeqAn, and lower memory footprint.
+* SeqLib has ~2-4x faster read/write speed over BamTools and lower memory footprint.
 * SeqLib has support for CRAM file
-* SeqLib provides in memory access to BWA-MEM, BLAT, a chromosome aware interval tree and range operations, and to read correction and sequence assembly with Fermi. BamTools has more support currently for network access. 
-* SeqAn provide a substantial amount of additional capabilites not in SeqLib, including graph operations and a more expanded suite of multi-sequence alignments.
+* SeqLib provides in memory access to BWA-MEM, BLAT, chromosome aware interval tree, read correction, and sequence assembly with Fermi.
+* SeqAn provide a substantial amount of additional capabilites not in SeqLib, including graph operations and an expanded suite of multi-sequence alignments.
+* SeqAn embeds multi-threading into some functionality like BAM IO to improve wall times.
 
 For your particular application, our hope is that SeqLib will provide a comprehensive and powerful envrionment to develop 
-bioinformatics tools. Feature requests and comments are welcomed.
+bioinformatics tools, or to be used in conjuction with the capablities in SeqAn and BamTools. Feature requests and comments are welcomed.
 
 Command Line Usage
 ------------------
@@ -152,7 +160,7 @@ bwa.ConstructIndex(usv);
 std::string querySeq = "CAGCCTCACCCAGGAAAGCAGCTGGGGGTCCACTGGGCTCAGGGAAG";
 BamRecordVector results;
 // hardclip=false, secondary score cutoff=0.9, max secondary alignments=10
-bwa.AlignSequence("my_seq", querySeq, results, false, 0.9, 10); 
+bwa.AlignSequence(querySeq, "my_seq", results, false, 0.9, 10); 
 
 // print results to stdout
 for (auto& i : results)
@@ -293,21 +301,22 @@ w.Close();               // Optional. Will close on destruction
 using namespace SeqLib;
 
 // brv is some set of reads to train the error corrector
-b.TrainCorrection(brv);
+for (BamRecordVector::const_iterator r = brv.begin(); r != brv.end(); ++r)
+    b.AddSequence(r->Sequence().c_str(), r->Qualities().c_str(), r->Qname().c_str());
+b.Train();
+b.clear(); // clear the training sequences. Training parameters saved in BFC object
+
 // brv2 is some set to correct
-b.ErrorCorrect(brv2);
+for (BamRecordVector::const_iterator r = brv2.begin(); r != brv2.end(); ++r)
+    b.AddSequence(r->Sequence().c_str(), r->Qualities().c_str(), r->Qname().c_str());
+b.ErrorCorrect();
 
 // retrieve the sequences
 UnalignedSequenceVector v;
-b.GetSequences(v);
-
-// alternatively, to train and correct the same set of reads
-b.TrainAndCorrect(brv);
-b.GetSequences(v);
+std::string name, seq;
+while (b.GetSequences(seq, name))
+  v.push_back({name, seq});      			   
 
-// alternatively, train and correct, and modify the sequence in-place
-b.TrainCorrection(brv);
-b.ErrorCorrectInPlace(brv);
 ```
 
 Support

SeqLib/BFC.h

@@ -24,6 +24,7 @@ namespace SeqLib {
   public:
     /** Construct a new BFC engine */
     BFC() {
+      m_idx = 0;
       bfc_opt_init(&bfc_opt);
       ch = NULL;
       kmer = 0;
@@ -43,57 +44,31 @@ namespace SeqLib {
 	bfc_ch_destroy(ch);
     }
 
-    /** Allocate a block of memory for the reads if the amount to enter is known 
-     * @note This is not necessary, as reads will dynamically reallocate 
-     */
-    bool AllocateMemory(size_t n);
-
     /** Peform BFC error correction on the sequences stored in this object */
     bool ErrorCorrect();
 
     /** Train the error corrector using the reads stored in this object */
     bool Train();
 
-    /** Add a sequence for either training or correction */
-    bool AddSequence(const BamRecord& r);
-
-    /** Add a sequence for either training or correction */
+    /** Add a sequence for either training or correction 
+     * @param seq A sequence to be copied into this object (A, T, C, G)
+     */
     bool AddSequence(const char* seq, const char* qual, const char* name);
 
-    /** Set the k-mer size */
-    void SetKmer(int k) { kmer = k; }
-
-    /** Train error correction using sequences from aligned reads */
-    void TrainCorrection(const BamRecordVector& brv);
-
-    /** Train error correction from raw character strings */
-    void TrainCorrection(const std::vector<char*>& v);
-
-    /** Train and error correction on same reads */
-    void TrainAndCorrect(const BamRecordVector& brv);
-
-    /** Error correct a collection of reads */
-    void ErrorCorrect(const BamRecordVector& brv);
-
-    /** Error correct in place, modify sequence, and the clear memory from this object */
-    void ErrorCorrectInPlace(BamRecordVector& brv);
-    
-    /** Error correct and add tag with the corrected sequence data, and the clear memory from this object 
-     * @param brv Aligned reads to error correct
-     * @param tag Tag to assign error corrected sequence to (eg KC)
-     * @exception Throws an invalid_argument if tag is not length 2
+    /** Set the k-mer size for training 
+     * @note zero is auto
      */
-    void ErrorCorrectToTag(BamRecordVector& brv, const std::string& tag);
+    void SetKmer(int k) { kmer = k; }
 
-    /** Return the reads (error corrected if ran ErrorCorrect) */
-    void GetSequences(UnalignedSequenceVector& v) const;
+    /** Correct a single new sequence not stored in object 
+     * @param str Sequence of string to correct (ACTG)
+     * @param q Quality score of sequence to correct 
+     * @value Returns true if corrected */
+    bool CorrectSequence(std::string& str, const std::string& q);
     
     /** Clear the stored reads */
     void clear();
 
-    /** Filter reads with unique k-mers. Do after error correction */
-    void FilterUnique();
-
     /** Return the calculated kcov */
     float GetKCov() const { return kcov; }
 
@@ -103,8 +78,21 @@ namespace SeqLib {
     /** Return the number of sequences controlled by this */
     int NumSequences() const { return n_seqs; } 
 
+    /** Return the next sequence stored in object 
+     * @param s Empty string to be filled.
+     * @param q Empty string name to be filled.
+     * @value True if string was filled with sequence. False if no more sequences.
+     */
+    bool GetSequence(std::string& s, std::string& q);
+
+    /** Reset the sequence iterator inside GetSequence 
+     */
+    void ResetGetSequence() { m_idx = 0; };
+
   private:
 
+    size_t m_idx;
+
     // the amount of memory allocated
     size_t m_seqs_size;
 
@@ -146,6 +134,8 @@ namespace SeqLib {
     // assign names, qualities and seq to m_seqs
     void allocate_sequences_from_char(const std::vector<char*>& v);
     
+    void allocate_sequences_from_strings(const std::vector<std::string>& v);
+    
     // do the actual read correction
     void correct_reads();
 

SeqLib/BamReader.h

@@ -42,7 +42,8 @@ namespace SeqLib {
   private:
 
     // do the read loading
-    bool load_read(BamRecord& r);
+    // the return value here is just passed along from sam_read1
+    int32_t load_read(BamRecord& r);
 
     void reset() {
       empty = true;

SeqLib/BamRecord.h

@@ -108,6 +108,14 @@ class CigarField {
 
  public:
 
+   /** Construct an empty CIGAR */
+   Cigar() {} 
+
+   /** Construct from a CIGAR string 
+    * @param cig CIGAR string, e.g. 54M46S
+    */
+   Cigar(const std::string& cig);
+
    typedef std::vector<CigarField>::iterator iterator; ///< Iterator for move between CigarField ops
    typedef std::vector<CigarField>::const_iterator const_iterator; ///< Iterator (const) for move between CigarField ops
    iterator begin() { return m_data.begin(); } ///< Iterator (aka std::vector<CigarField>.begin()
@@ -185,11 +193,8 @@ class CigarField {
 
  };
 
- //typedef std::vector<CigarField> Cigar;
  typedef SeqHashMap<std::string, size_t> CigarMap;
 
- Cigar cigarFromString(const std::string& cig);
-
 /** Class to store and interact with a SAM alignment record
  *
  * HTSLibrary reads are stored in the bam1_t struct. Memory allocation
@@ -345,7 +350,10 @@ class BamRecord {
   int32_t CountBWAChimericAlignments() const;
 
   /** Get the end of the alignment */
-  inline int32_t PositionEnd() const { return b ? bam_endpos(b.get()) : -1; }
+  int32_t PositionEnd() const;
+
+  /** Get the end of the aligment mate pair */
+  int32_t PositionEndMate() const;
 
   /** Get the chromosome ID of the read */
   inline int32_t ChrID() const { return b ? b->core.tid : -1; }
@@ -398,8 +406,8 @@ class BamRecord {
   inline std::string ParseReadGroup() const {
 
     // try to get from RG tag first
-    std::string RG = GetZTag("RG");
-    if (!RG.empty())
+    std::string RG;
+    if (GetZTag("RG", RG))
       return RG;
 
     // try to get the read group tag from qname second
@@ -414,7 +422,7 @@ class BamRecord {
     if (b->core.tid != b->core.mtid || !PairMappedFlag())
       return 0;
 
-    return std::abs(b->core.pos - b->core.mpos) + Length();
+    return std::abs(b->core.pos - b->core.mpos) + GetCigar().NumQueryConsumed();
 
   }
   
@@ -559,8 +567,8 @@ class BamRecord {
     uint8_t * p = bam_get_qual(b);
     if (!p)
       return std::string();
-    if (!p[0])
-      return std::string();
+    //if (!p[0])
+    //  return std::string();
     std::string out(b->core.l_qseq, ' ');
     for (int32_t i = 0; i < b->core.l_qseq; ++i) 
       out[i] = (char)(p[i] + offset);
@@ -659,9 +667,17 @@ class BamRecord {
   
   /** Get a string (Z) tag 
    * @param tag Name of the tag. eg "XP"
-   * @return The value stored in the tag. Returns empty string if it does not exist.
+   * @param s The string to be filled in with the tag information
+   * @return Returns true if the tag is present, even if empty. Return false if no tag or not a Z tag.
    */
-  std::string GetZTag(const std::string& tag) const;
+  bool GetZTag(const std::string& tag, std::string& s) const;
+  
+  /** Get a string of either Z, f or i type. Useful if tag type not known at compile time.
+   * @param tag Name of the tag. eg "XP"
+   * @param s The string to be filled in with the tag information
+   * @return Returns true if the tag is present and is either Z or i, even if empty. Return false if no tag or not Z or i.
+   */  
+  bool GetTag(const std::string& tag, std::string& s) const;
   
   /** Get a vector of type int from a Z tag delimited by "^"
    * Smart-tags allow one to store vectors of strings, ints or doubles in the alignment tags, and
@@ -691,13 +707,28 @@ class BamRecord {
 
   /** Get an int (i) tag 
    * @param tag Name of the tag. eg "XP"
-   * @return The value stored in the tag. Returns 0 if it does not exist.
+   * @param t Value to be filled in with the tag value.
+   * @return Return true if the tag exists.
    */
-  inline int32_t GetIntTag(const std::string& tag) const {
+  inline bool GetIntTag(const std::string& tag, int32_t& t) const {
     uint8_t* p = bam_aux_get(b.get(),tag.c_str());
     if (!p)
-      return 0;
-    return bam_aux2i(p);
+      return false;
+    t = bam_aux2i(p);
+    return true;
+  }
+
+  /** Get a float (f) tag 
+   * @param tag Name of the tag. eg "AS"
+   * @param t Value to be filled in with the tag value.
+   * @return Return true if the tag exists.
+   */
+  inline bool GetFloatTag(const std::string& tag, float& t) const {
+    uint8_t* p = bam_aux_get(b.get(),tag.c_str());
+    if (!p)
+      return false;
+    t = bam_aux2f(p);
+    return true;
   }
 
   /** Add a string (Z) tag
@@ -825,7 +856,10 @@ class BamRecord {
    */
   int OverlappingCoverage(const BamRecord& r) const;
   
-  private:
+  /** Return the shared pointer */
+  SeqPointer<bam1_t> shared_pointer() const { return b; }
+
+  protected:
   
   SeqPointer<bam1_t> b; // bam1_t shared pointer
 

SeqLib/SeqLibUtils.h

-#ifndef SNOWUTILS_H
-#define SNOWUTILS_H
+#ifndef SEQLIB_UTILS_H
+#define SEQLIB_UTILS_H
 
 #include <string>
 #include <time.h>

SeqLib/UnalignedSequence.h

-#ifndef SEQLIB_UNALIGNED_SEQ_H__
-#define SEQLIB_UNALIGNED_SEQ_H__
+#ifndef SEQLIB_UNALIGNED_SEQ_H
+#define SEQLIB_UNALIGNED_SEQ_H
 
 extern "C" {
   #include "bwa/bwa.h"
@@ -26,20 +26,20 @@ namespace SeqLib {
     /** Construct an empty sequence */
     UnalignedSequence() {}
   
-    /** Construct an unaliged sequence with name and sequence
+    /** Construct an unaligned sequence with name and sequence
      * @param n Name of the sequence 
      * @param s Sequence, stored as ACTG or N characters
      */
     UnalignedSequence(const std::string& n, const std::string& s) : Name(n), Seq(s), Qual(std::string()), Strand('*') {}
 
-    /** Construct an unaliged sequence with name, sequence and quality score
+    /** Construct an unaligned sequence with name, sequence and quality score
      * @param n Name of the sequence 
      * @param s Sequence, stored as ACTG or N characters
      * @param q Quality string
      */
     UnalignedSequence(const std::string& n, const std::string& s, const std::string& q) : Name(n), Seq(s), Qual(q), Strand('*') {}
 
-    /** Construct an unaliged sequence with name, sequence and quality score
+    /** Construct an unaligned sequence with name, sequence, quality score and strand
      * @param n Name of the sequence 
      * @param s Sequence, stored as ACTG or N characters
      * @param q Quality string

benchmark/Makefile

 ##INCLUDES=-I/xchip/gistic/Jeremiah/software/seqan-library-2.0.2/include -I /xchip/gistic/Jeremiah/GIT/SeqLib/src -I/xchip/gistic/Jeremiah/GIT/SeqLib/htslib -I/xchip/gistic/Jeremiah/software/boost_1.61.0_gcc5.1 -I/xchip/gistic/Jeremiah/software/bamtools-2.4.0/include
-INCLUDES=-I/xchip/gistic/Jeremiah/software/seqan-library-2.2.0/include -I /xchip/gistic/Jeremiah/GIT/SeqLib/src -I/xchip/gistic/Jeremiah/GIT/SeqLib/htslib -I/xchip/gistic/Jeremiah/software/boost_1.61.0_gcc5.1 -I/xchip/gistic/Jeremiah/software/bamtools-2.4.0/include -I/xchip/gistic/Jeremiah/software/bzip2-1.0.6
+INCLUDES=-I/xchip/gistic/Jeremiah/software/seqan-library-2.2.0/include -I /xchip/gistic/Jeremiah/GIT/SeqLib -I/xchip/gistic/Jeremiah/GIT/SeqLib/htslib -I/xchip/gistic/Jeremiah/software/boost_1.61.0_gcc5.1 -I/xchip/gistic/Jeremiah/software/bamtools-2.4.0/include -I/xchip/gistic/Jeremiah/software/bzip2-1.0.6
 LIBS=/xchip/gistic/Jeremiah/software/bamtools-2.4.0/lib/libbamtools.a /xchip/gistic/Jeremiah/GIT/SeqLib/src/libseqlib.a /xchip/gistic/Jeremiah/GIT/SeqLib/htslib/libhts.a /xchip/gistic/Jeremiah/software/boost_1.61.0_gcc5.1/stage/lib/libboost_timer.a /xchip/gistic/Jeremiah/software/boost_1.61.0_gcc5.1/stage/lib/libboost_chrono.a /xchip/gistic/Jeremiah/software/boost_1.61.0_gcc5.1/stage/lib/libboost_system.a /xchip/gistic/Jeremiah/software/bzip2-1.0.6/libbz2.a
-CFLAGS=-W -Wall -pedantic -std=c++14 -DSEQAN_HAS_ZLIB=1 -DSEQAN_HAS_BZIP2=1
+CXXFLAGS=-W -Wall -pedantic -std=c++14 -DSEQAN_HAS_ZLIB=1 -DSEQAN_HAS_BZIP2=1 -O3 -DNDEBUG -DSEQAN_ENABLE_DEBUG=0 -DSEQAN_ENABLE_TESTING=0
 
 binaries=benchmark
 
 all: benchmark.o
-	g++ benchmark.o -g -o benchmark $(LIBS) -lrt -lpthread -lz -lm
+	g++ benchmark.o -o benchmark $(LIBS) -lrt -lpthread -lz -lm
 
 benchmark.o: benchmark.cpp
-	g++ -g -c benchmark.cpp $(INCLUDES) $(CFLAGS)
+	g++ -c benchmark.cpp $(INCLUDES) $(CXXFLAGS)
 
 .PHONY: clean
 

benchmark/benchmark.cpp

 #define USE_BOOST
 
-#define JUMPING_TEST 1
-//#define READ_TEST 1
+//#define JUMPING_TEST 1
+#define READ_TEST 1
 
 #include "SeqLib/SeqLibUtils.h"
 
@@ -14,6 +14,7 @@
 //#define RUN_SEQAN 1
 //#define RUN_BAMTOOLS 1
 #define RUN_SEQLIB 1
+//#define RUN_HTSLIB 1
 
 #ifdef RUN_SEQAN
 #include <seqan/bam_io.h>
@@ -26,7 +27,18 @@ using namespace seqan;
 #include "SeqLib/BamWriter.h"
 #endif
 
-#define BAMTOOLS_GET_CORE 1
+#ifdef RUN_HTSLIB
+#include <iostream>
+extern "C" {
+#include "htslib/htslib/hts.h"
+#include "htslib/htslib/sam.h"
+#include "htslib/htslib/bgzf.h"
+#include "htslib/htslib/kstring.h"
+#include "htslib/htslib/faidx.h"
+}
+#endif
+
+//#define BAMTOOLS_GET_CORE 1
 
 #ifdef RUN_BAMTOOLS
 #include "api/BamReader.h"
@@ -37,7 +49,9 @@ int main()
   
   const size_t limit       = 5000000;
   const size_t print_limit = 1000000;
+#ifdef JUMPING_TEST
   const size_t jump_limit  = 1000;
+#endif
   size_t count = 0;
 
   //std::string bam  = "/xchip/gistic/Jeremiah/GIT/SeqLib/seq_test/test_data/small.bam";
@@ -99,13 +113,18 @@ int main()
 
   SeqLib::BamRecord rec;
   SeqLib::BamRecordVector bav;
+  std::string dummy;
+  std::stringstream ss;
 #ifdef READ_TEST
   std::vector<std::string> sq;
   while(r.GetNextRecord(rec) && count++ < limit) {
     if (count % print_limit == 0)
       std::cerr << "...at read " << SeqLib::AddCommas(count) << std::endl;
     bav.push_back(rec);
+    //dummy = rec.Sequence();
     //sq.push_back(rec.Sequence());
+    //sq.push_back(rec.Qname());
+    //sq.push_back(rec.CigarString());
   }
 #endif
 
@@ -162,6 +181,7 @@ int main()
     }
 
   bool hasAlignments = false;
+  long l = 0;
   for (int i = 0; i < jump_limit; ++i) {
     int chr = rand() % 22;
     int pos = rand() % 1000000 + 1000000;
@@ -171,7 +191,8 @@ int main()
       }
     if (hasAlignments) {
 	  readRecord(record, bamFileIn);
-	  bav.push_back(record);
+	  l += getAlignmentLengthInRef(record);
+	  //bav.push_back(record);
     } else {
       std::cerr << "no alignments here " << std::endl;
     }
@@ -200,6 +221,47 @@ int main()
     }
 #endif
 
+#endif
+
+#ifdef RUN_HTSLIB
+
+  std::cerr << " **** RUNNING HTSLIB **** " << std::endl;
+  bam1_t* b = bam_init1();
+  htsFile* in = hts_open(bam.c_str(), "r");
+  bam_hdr_t* header;
+  if (in == NULL)
+    return -1;
+  if (b == NULL)
+    return -1;
+  header = sam_hdr_read(in);
+  int i = 0;
+  std::vector<bam1_t*> bav;
+  while (sam_read1(in, header, b) >= 0 && count++ < limit) {
+    if (count % print_limit == 0)
+      std::cerr << "...at read " << SeqLib::AddCommas(count) << std::endl;
+    bav.push_back(b);
+    /*
+        int i;
+        const bam1_core_t* c = &b->core;
+        uint8_t *s = bam1_seq(b), *t = bam1_qual(b);
+        fwrite(bam1_qname(b), c->l_qname - 1, sizeof(char), stdout);
+        fputc('\t', stdout);
+        for (i = 0; i < c->l_qseq; ++i)
+            fputc(bam_nt16_rev_table[bam1_seqi(s, i)], stdout);
+        fputc('\t', stdout);
+        if (t[0] == 0xff) {
+            fputs("*", stdout);
+        }
+        else {
+            for (i = 0; i < c->l_qseq; ++i)
+                fputc(t[i] + 33, stdout);
+        }
+        fputc('\n', stdout);
+    */
+  }
+  printf("%d", i);
+  bam_hdr_destroy(header);
+  hts_close(in);
 #endif
 
   std::cerr << " Copied " << bav.size() << " records " << std::endl;

configure

@@ -703,7 +703,6 @@ infodir
 docdir
 oldincludedir
 includedir
-runstatedir
 localstatedir
 sharedstatedir
 sysconfdir
@@ -781,7 +780,6 @@ datadir='${datarootdir}'
 sysconfdir='${prefix}/etc'
 sharedstatedir='${prefix}/com'
 localstatedir='${prefix}/var'
-runstatedir='${localstatedir}/run'
 includedir='${prefix}/include'
 oldincludedir='/usr/include'
 docdir='${datarootdir}/doc/${PACKAGE_TARNAME}'
@@ -1034,15 +1032,6 @@ do
   | -silent | --silent | --silen | --sile | --sil)
     silent=yes ;;
 
-  -runstatedir | --runstatedir | --runstatedi | --runstated \
-  | --runstate | --runstat | --runsta | --runst | --runs \
-  | --run | --ru | --r)
-    ac_prev=runstatedir ;;
-  -runstatedir=* | --runstatedir=* | --runstatedi=* | --runstated=* \
-  | --runstate=* | --runstat=* | --runsta=* | --runst=* | --runs=* \
-  | --run=* | --ru=* | --r=*)
-    runstatedir=$ac_optarg ;;
-
   -sbindir | --sbindir | --sbindi | --sbind | --sbin | --sbi | --sb)
     ac_prev=sbindir ;;
   -sbindir=* | --sbindir=* | --sbindi=* | --sbind=* | --sbin=* \
@@ -1180,7 +1169,7 @@ fi
 for ac_var in	exec_prefix prefix bindir sbindir libexecdir datarootdir \
 		datadir sysconfdir sharedstatedir localstatedir includedir \
 		oldincludedir docdir infodir htmldir dvidir pdfdir psdir \
-		libdir localedir mandir runstatedir
+		libdir localedir mandir
 do
   eval ac_val=\$$ac_var
   # Remove trailing slashes.
@@ -1333,7 +1322,6 @@ Fine tuning of the installation directories:
   --sysconfdir=DIR        read-only single-machine data [PREFIX/etc]
   --sharedstatedir=DIR    modifiable architecture-independent data [PREFIX/com]
   --localstatedir=DIR     modifiable single-machine data [PREFIX/var]
-  --runstatedir=DIR       modifiable per-process data [LOCALSTATEDIR/run]
   --libdir=DIR            object code libraries [EPREFIX/lib]
   --includedir=DIR        C header files [PREFIX/include]
   --oldincludedir=DIR     C header files for non-gcc [/usr/include]

debian/changelog

-libseqlib (1.1.1+dfsg-6) UNRELEASED; urgency=medium
+libseqlib (1.1.2+dfsg-1) UNRELEASED; urgency=medium
 
   * Fix watch file
   * Add symbols file
+  * New upstream version
+  * Point Vcs fields to salsa.debian.org
+  * Standards-Version: 4.1.4
+  * Bump ABI version due to upstream changes (see
+     https://github.com/walaj/SeqLib/issues/24 )
 
- -- Andreas Tille <tille@debian.org>  Wed, 23 May 2018 10:09:08 +0200
+ -- Andreas Tille <tille@debian.org>  Wed, 23 May 2018 10:21:45 +0200
 
 libseqlib (1.1.1+dfsg-5) unstable; urgency=medium
 

debian/control

@@ -13,12 +13,12 @@ Build-Depends: debhelper (>= 11~),
                libbwa-dev (>= 0.7.15-3),
                libjsoncpp-dev,
                libssw-dev
-Standards-Version: 4.1.3
-Vcs-Browser: https://anonscm.debian.org/cgit/debian-med/libseqlib.git
-Vcs-Git: https://anonscm.debian.org/git/debian-med/libseqlib.git
+Standards-Version: 4.1.4
+Vcs-Browser: https://salsa.debian.org/med-team/libseqlib
+Vcs-Git: https://salsa.debian.org/med-team/libseqlib.git
 Homepage: https://github.com/walaj/SeqLib
 
-Package: libseqlib0
+Package: libseqlib1
 Architecture: any
 Section: libs
 Depends: ${shlibs:Depends},
@@ -39,7 +39,7 @@ Description: C++ htslib/bwa-mem/fermi interface for interrogating sequence data
 Package: libseqlib-dev
 Architecture: any
 Section: libdevel
-Depends: libseqlib0 (= ${binary:Version}),
+Depends: libseqlib1 (= ${binary:Version}),
          ${shlibs:Depends},
          ${misc:Depends},
          libhts-dev (>= 1.3.2-3),

debian/libseqlib0.symbols → debian/libseqlib1.symbols

@@ -57,7 +57,7 @@ libseqlib.so.0 libseqlib0 #MINVER#
  _ZN6SeqLib14FermiAssemblerC2Ev@Base 1.1.1+dfsg
  _ZN6SeqLib14FermiAssemblerD1Ev@Base 1.1.1+dfsg
  _ZN6SeqLib14FermiAssemblerD2Ev@Base 1.1.1+dfsg
- _ZN6SeqLib15cigarFromStringERKNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEE@Base 1.1.1+dfsg
+#MISSING: 1.1.2+dfsg# _ZN6SeqLib15cigarFromStringERKNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEE@Base 1.1.1+dfsg
  _ZN6SeqLib17UnalignedSequenceD1Ev@Base 1.1.1+dfsg
  _ZN6SeqLib17UnalignedSequenceD2Ev@Base 1.1.1+dfsg
  _ZN6SeqLib23GenomicRegionCollectionINS_13GenomicRegionEE12allocate_grcEv@Base 1.1.1+dfsg
@@ -74,20 +74,22 @@ libseqlib.so.0 libseqlib0 #MINVER#
  _ZN6SeqLib23GenomicRegionCollectionINS_13GenomicRegionEED1Ev@Base 1.1.1+dfsg
  _ZN6SeqLib23GenomicRegionCollectionINS_13GenomicRegionEED2Ev@Base 1.1.1+dfsg
  _ZN6SeqLib3BFC11AddSequenceEPKcS2_S2_@Base 1.1.1+dfsg
- _ZN6SeqLib3BFC11AddSequenceERKNS_9BamRecordE@Base 1.1.1+dfsg
- _ZN6SeqLib3BFC12ErrorCorrectERKSt6vectorINS_9BamRecordESaIS2_EE@Base 1.1.1+dfsg
+#MISSING: 1.1.2+dfsg# _ZN6SeqLib3BFC11AddSequenceERKNS_9BamRecordE@Base 1.1.1+dfsg
+ _ZN6SeqLib3BFC11GetSequenceERNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEES7_@Base 1.1.2+dfsg
+#MISSING: 1.1.2+dfsg# _ZN6SeqLib3BFC12ErrorCorrectERKSt6vectorINS_9BamRecordESaIS2_EE@Base 1.1.1+dfsg
  _ZN6SeqLib3BFC12ErrorCorrectEv@Base 1.1.1+dfsg
- _ZN6SeqLib3BFC12FilterUniqueEv@Base 1.1.1+dfsg
+#MISSING: 1.1.2+dfsg# _ZN6SeqLib3BFC12FilterUniqueEv@Base 1.1.1+dfsg
  _ZN6SeqLib3BFC13correct_readsEv@Base 1.1.1+dfsg
  _ZN6SeqLib3BFC13learn_correctEv@Base 1.1.1+dfsg
- _ZN6SeqLib3BFC14AllocateMemoryEm@Base 1.1.1+dfsg
- _ZN6SeqLib3BFC15TrainAndCorrectERKSt6vectorINS_9BamRecordESaIS2_EE@Base 1.1.1+dfsg
- _ZN6SeqLib3BFC15TrainCorrectionERKSt6vectorINS_9BamRecordESaIS2_EE@Base 1.1.1+dfsg
- _ZN6SeqLib3BFC15TrainCorrectionERKSt6vectorIPcSaIS2_EE@Base 1.1.1+dfsg
- _ZN6SeqLib3BFC17ErrorCorrectToTagERSt6vectorINS_9BamRecordESaIS2_EERKNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEE@Base 1.1.1+dfsg
- _ZN6SeqLib3BFC19ErrorCorrectInPlaceERSt6vectorINS_9BamRecordESaIS2_EE@Base 1.1.1+dfsg
- _ZN6SeqLib3BFC28allocate_sequences_from_charERKSt6vectorIPcSaIS2_EE@Base 1.1.1+dfsg
- _ZN6SeqLib3BFC29allocate_sequences_from_readsERKSt6vectorINS_9BamRecordESaIS2_EE@Base 1.1.1+dfsg
+#MISSING: 1.1.2+dfsg# _ZN6SeqLib3BFC14AllocateMemoryEm@Base 1.1.1+dfsg
+ _ZN6SeqLib3BFC15CorrectSequenceERNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEERKS6_@Base 1.1.2+dfsg
+#MISSING: 1.1.2+dfsg# _ZN6SeqLib3BFC15TrainAndCorrectERKSt6vectorINS_9BamRecordESaIS2_EE@Base 1.1.1+dfsg
+#MISSING: 1.1.2+dfsg# _ZN6SeqLib3BFC15TrainCorrectionERKSt6vectorINS_9BamRecordESaIS2_EE@Base 1.1.1+dfsg
+#MISSING: 1.1.2+dfsg# _ZN6SeqLib3BFC15TrainCorrectionERKSt6vectorIPcSaIS2_EE@Base 1.1.1+dfsg
+#MISSING: 1.1.2+dfsg# _ZN6SeqLib3BFC17ErrorCorrectToTagERSt6vectorINS_9BamRecordESaIS2_EERKNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEE@Base 1.1.1+dfsg
+#MISSING: 1.1.2+dfsg# _ZN6SeqLib3BFC19ErrorCorrectInPlaceERSt6vectorINS_9BamRecordESaIS2_EE@Base 1.1.1+dfsg
+#MISSING: 1.1.2+dfsg# _ZN6SeqLib3BFC28allocate_sequences_from_charERKSt6vectorIPcSaIS2_EE@Base 1.1.1+dfsg
+#MISSING: 1.1.2+dfsg# _ZN6SeqLib3BFC29allocate_sequences_from_readsERKSt6vectorINS_9BamRecordESaIS2_EE@Base 1.1.1+dfsg
  _ZN6SeqLib3BFC5TrainEv@Base 1.1.1+dfsg
  _ZN6SeqLib3BFC5clearEv@Base 1.1.1+dfsg
  _ZN6SeqLib4_Bam20open_BAM_for_readingEv@Base 1.1.1+dfsg
@@ -95,6 +97,8 @@ libseqlib.so.0 libseqlib0 #MINVER#
  _ZN6SeqLib4_Bam9load_readERNS_9BamRecordE@Base 1.1.1+dfsg
  _ZN6SeqLib4_BamD1Ev@Base 1.1.1+dfsg
  _ZN6SeqLib4_BamD2Ev@Base 1.1.1+dfsg
+ _ZN6SeqLib5CigarC1ERKNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEE@Base 1.1.2+dfsg
+ _ZN6SeqLib5CigarC2ERKNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEE@Base 1.1.2+dfsg
  _ZN6SeqLib6Filter10ReadFilter10addRegionsERKNS_23GenomicRegionCollectionINS_13GenomicRegionEEE@Base 1.1.1+dfsg
  _ZN6SeqLib6Filter10ReadFilter10setRegionsERKNS_23GenomicRegionCollectionINS_13GenomicRegionEEE@Base 1.1.1+dfsg
  _ZN6SeqLib6Filter10ReadFilter7AddRuleERKNS0_12AbstractRuleE@Base 1.1.1+dfsg
@@ -210,7 +214,7 @@ libseqlib.so.0 libseqlib0 #MINVER#
  _ZNK6SeqLib14FermiAssembler10GetContigsB5cxx11Ev@Base 1.1.1+dfsg
  _ZNK6SeqLib14FermiAssembler12GetSequencesEv@Base 1.1.1+dfsg
  _ZNK6SeqLib23GenomicRegionCollectionINS_13GenomicRegionEE13CountOverlapsERKS1_@Base 1.1.1+dfsg
- _ZNK6SeqLib3BFC12GetSequencesERSt6vectorINS_17UnalignedSequenceESaIS2_EE@Base 1.1.1+dfsg
+#MISSING: 1.1.2+dfsg# _ZNK6SeqLib3BFC12GetSequencesERSt6vectorINS_17UnalignedSequenceESaIS2_EE@Base 1.1.1+dfsg
  _ZNK6SeqLib5CigareqERKS0_@Base 1.1.1+dfsg
  _ZNK6SeqLib6Filter10ReadFilter23isReadOverlappingRegionERKNS_9BamRecordE@Base 1.1.1+dfsg
  _ZNK6SeqLib6Filter11AhoCorasick9QueryTextERKNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEE@Base 1.1.1+dfsg
@@ -229,10 +233,12 @@ libseqlib.so.0 libseqlib0 #MINVER#
  _ZNK6SeqLib9BamReader12PrintRegionsB5cxx11Ev@Base 1.1.1+dfsg
  _ZNK6SeqLib9BamReader6HeaderEv@Base 1.1.1+dfsg
  _ZNK6SeqLib9BamRecord11CountNBasesEv@Base 1.1.1+dfsg
+ _ZNK6SeqLib9BamRecord11PositionEndEv@Base 1.1.2+dfsg
  _ZNK6SeqLib9BamRecord14GetSmartIntTagERKNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEE@Base 1.1.1+dfsg
  _ZNK6SeqLib9BamRecord14ParseReadGroupB5cxx11Ev@Base 1.1.1+dfsg
  _ZNK6SeqLib9BamRecord15AsGenomicRegionEv@Base 1.1.1+dfsg
  _ZNK6SeqLib9BamRecord15PairOrientationEv@Base 1.1.1+dfsg
+ _ZNK6SeqLib9BamRecord15PositionEndMateEv@Base 1.1.2+dfsg
  _ZNK6SeqLib9BamRecord15QualitySequenceB5cxx11Ev@Base 1.1.1+dfsg
  _ZNK6SeqLib9BamRecord17GetSmartDoubleTagERKNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEE@Base 1.1.1+dfsg
  _ZNK6SeqLib9BamRecord17GetSmartStringTagERKNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEE@Base 1.1.1+dfsg
@@ -241,7 +247,9 @@ libseqlib.so.0 libseqlib0 #MINVER#
  _ZNK6SeqLib9BamRecord22QualityTrimmedSequenceEiRiS1_@Base 1.1.1+dfsg
  _ZNK6SeqLib9BamRecord26CountBWAChimericAlignmentsEv@Base 1.1.1+dfsg
  _ZNK6SeqLib9BamRecord27CountBWASecondaryAlignmentsEv@Base 1.1.1+dfsg
- _ZNK6SeqLib9BamRecord7GetZTagERKNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEE@Base 1.1.1+dfsg
+ _ZNK6SeqLib9BamRecord6GetTagERKNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEERS6_@Base 1.1.2+dfsg
+#MISSING: 1.1.2+dfsg# _ZNK6SeqLib9BamRecord7GetZTagERKNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEE@Base 1.1.1+dfsg
+ _ZNK6SeqLib9BamRecord7GetZTagERKNSt7__cxx1112basic_stringIcSt11char_traitsIcESaIcEEERS6_@Base 1.1.2+dfsg
  _ZNK6SeqLib9BamRecord8SequenceB5cxx11Ev@Base 1.1.1+dfsg
  _ZNK6SeqLib9BamRecord9MeanPhredEv@Base 1.1.1+dfsg
  _ZNK6SeqLib9BamWriter10BuildIndexEv@Base 1.1.1+dfsg
@@ -347,7 +355,7 @@ libseqlib.so.0 libseqlib0 #MINVER#
  _ZNSt6vectorIN6SeqLib14HeaderSequenceESaIS1_EE17_M_realloc_insertIJS1_EEEvN9__gnu_cxx17__normal_iteratorIPS1_S3_EEDpOT_@Base 1.1.1+dfsg
  _ZNSt6vectorIN6SeqLib15PlottedReadLineESaIS1_EE17_M_realloc_insertIJRKS1_EEEvN9__gnu_cxx17__normal_iteratorIPS1_S3_EEDpOT_@Base 1.1.1+dfsg
  _ZNSt6vectorIN6SeqLib17UnalignedSequenceESaIS1_EE17_M_realloc_insertIJRKS1_EEEvN9__gnu_cxx17__normal_iteratorIPS1_S3_EEDpOT_@Base 1.1.1+dfsg
- _ZNSt6vectorIN6SeqLib17UnalignedSequenceESaIS1_EE17_M_realloc_insertIJS1_EEEvN9__gnu_cxx17__normal_iteratorIPS1_S3_EEDpOT_@Base 1.1.1+dfsg
+#MISSING: 1.1.2+dfsg# _ZNSt6vectorIN6SeqLib17UnalignedSequenceESaIS1_EE17_M_realloc_insertIJS1_EEEvN9__gnu_cxx17__normal_iteratorIPS1_S3_EEDpOT_@Base 1.1.1+dfsg
  _ZNSt6vectorIN6SeqLib6Filter10ReadFilterESaIS2_EE17_M_realloc_insertIJRKS2_EEEvN9__gnu_cxx17__normal_iteratorIPS2_S4_EEDpOT_@Base 1.1.1+dfsg
  _ZNSt6vectorIN6SeqLib6Filter12AbstractRuleESaIS2_EE17_M_realloc_insertIJRKS2_EEEvN9__gnu_cxx17__normal_iteratorIPS2_S4_EEDpOT_@Base 1.1.1+dfsg
  _ZNSt6vectorIN6SeqLib9BamRecordESaIS1_EE17_M_realloc_insertIJRKS1_EEEvN9__gnu_cxx17__normal_iteratorIPS1_S3_EEDpOT_@Base 1.1.1+dfsg

debian/patches/adapt_to_debian_fermi-lite.patch

@@ -6,7 +6,7 @@ Description: In Debian's fermi-lite 0.1-3 a name space pollution with
 
 --- a/SeqLib/BFC.h
 +++ b/SeqLib/BFC.h
-@@ -129,7 +129,7 @@ namespace SeqLib {
+@@ -117,7 +117,7 @@ namespace SeqLib {
      float kcov;
  
      // reads to correct in place
@@ -36,16 +36,7 @@ Description: In Debian's fermi-lite 0.1-3 a name space pollution with
  
  #include <stdexcept>
  #include <algorithm>
-@@ -43,7 +44,7 @@ namespace SeqLib {
-       return false;
-     
-     m_seqs_size = n;
--    m_seqs = (fseq1_t*)realloc(m_seqs, n * sizeof(fseq1_t));
-+    m_seqs = (fml_seq1_t*)realloc(m_seqs, n * sizeof(fml_seq1_t));
- 
-     if (!m_seqs)
-       return false;
-@@ -78,12 +79,12 @@ namespace SeqLib {
+@@ -42,12 +43,12 @@ namespace SeqLib {
      // do the intial allocation
      if (n_seqs == 0 && !m_seqs) {
        m_seqs_size = 32;
@@ -60,7 +51,7 @@ Description: In Debian's fermi-lite 0.1-3 a name space pollution with
      }
  
      if (!m_seqs)
-@@ -96,7 +97,7 @@ namespace SeqLib {
+@@ -60,7 +61,7 @@ namespace SeqLib {
      if (!strlen(seq))
        return false;
  
@@ -69,38 +60,22 @@ Description: In Debian's fermi-lite 0.1-3 a name space pollution with
      
      s = &m_seqs[n_seqs];
      
-@@ -245,12 +246,12 @@ namespace SeqLib {
-   void BFC::allocate_sequences_from_char(const std::vector<char*>& v) {
+@@ -108,13 +109,13 @@ namespace SeqLib {
+     assert(n_seqs == 0);
+     assert(m_names.size() == 0);
  
-     m_seqs_size = v.size();
--    m_seqs = (fseq1_t*)malloc(v.size() * sizeof(fseq1_t));
-+    m_seqs = (fml_seq1_t*)malloc(v.size() * sizeof(fml_seq1_t));
+-    m_seqs = (fseq1_t*)malloc(1 * sizeof(fseq1_t));
++    m_seqs = (fml_seq1_t*)malloc(1 * sizeof(fml_seq1_t));
+     n_seqs = 1;
      
-     uint64_t size = 0;
-     for (std::vector<char*>::const_iterator r = v.begin(); r != v.end(); ++r) {
+     //uint64_t size = 0;
+     //for (std::vector<char*>::const_iterator r = v.begin(); r != v.end(); ++r) {
      //    for (auto& r : v) {
 -    fseq1_t *s;
 +    fml_seq1_t *s;
-       
-       s = &m_seqs[n_seqs];
-       
-@@ -268,14 +269,14 @@ namespace SeqLib {
-       
-     // alloc the memory
-     m_seqs_size = brv.size();
--    m_seqs = (fseq1_t*)malloc(brv.size() * sizeof(fseq1_t));
-+    m_seqs = (fml_seq1_t*)malloc(brv.size() * sizeof(fml_seq1_t));
-     
-     uint64_t size = 0;
-     for (BamRecordVector::const_iterator r = brv.begin(); r != brv.end(); ++r) {
-       //    for (auto& r : brv) {
-       m_names.push_back(strdup(r->Qname().c_str()));
- 
--      fseq1_t *s;
-+      fml_seq1_t *s;
-       
-       s = &m_seqs[n_seqs];
- 
+     s = &m_seqs[0];
+     s->seq   = strdup(str.c_str());
+     s->qual  = q.empty() || q.length() != str.length() ? NULL : strdup(q.c_str()); 
 --- a/src/FermiAssembler.cpp
 +++ b/src/FermiAssembler.cpp
 @@ -41,13 +41,13 @@ namespace SeqLib {
@@ -133,14 +108,13 @@ Description: In Debian's fermi-lite 0.1-3 a name space pollution with
  
        s = &m_seqs[n_seqs];
  
-@@ -81,13 +81,13 @@ namespace SeqLib {
+@@ -81,12 +81,12 @@ namespace SeqLib {
    void FermiAssembler::AddReads(const BamRecordVector& brv) {
  
      // alloc the memory
 -    m_seqs = (fseq1_t*)realloc(m_seqs, (n_seqs + brv.size()) * sizeof(fseq1_t));
 +    m_seqs = (fml_seq1_t*)realloc(m_seqs, (n_seqs + brv.size()) * sizeof(fml_seq1_t));
  
-     int m = 0;
      uint64_t size = 0;
      for (BamRecordVector::const_iterator r = brv.begin(); r != brv.end(); ++r) {
        m_names.push_back(r->Qname());
@@ -149,7 +123,7 @@ Description: In Debian's fermi-lite 0.1-3 a name space pollution with
        
        s = &m_seqs[n_seqs];
        
-@@ -111,7 +111,7 @@ namespace SeqLib {
+@@ -110,7 +110,7 @@ namespace SeqLib {
        return; //already cleared
  
      for (size_t i = 0; i < n_seqs; ++i) {
@@ -158,7 +132,7 @@ Description: In Debian's fermi-lite 0.1-3 a name space pollution with
        if (s->qual)
         free(s->qual); 
        s->qual = NULL;
-@@ -164,7 +164,7 @@ namespace SeqLib {
+@@ -163,7 +163,7 @@ namespace SeqLib {
      
      UnalignedSequenceVector r;
      for (size_t i = 0; i < n_seqs; ++i) {

debian/patches/dynamic_lib.patch

@@ -22,7 +22,7 @@ Description: Create dynamic library
  AM_MAINTAINER_MODE([disable])
  ##m4_include([m4/m4_ax_openmp.m4])
  
-+LIB_VERSION=0:0
++LIB_VERSION=1:0
 +
 +AC_SUBST([VERSION])
 +AC_SUBST([LIB_VERSION])

debian/patches/fml_include_path.patch

@@ -20,7 +20,7 @@ Description: Make sure header files will be found in /usr/include/fml
 -	../htslib/libhts.a \
  	-lboost_unit_test_framework -lboost_system -lboost_timer -lboost_chrono
  
- seq_test_LDFLAGS = --coverage
+ seq_test_LDFLAGS = --coverage -pthread
 --- a/src/Makefile.am
 +++ b/src/Makefile.am
 @@ -1,6 +1,6 @@

seq_test/Makefile.am

@@ -12,7 +12,7 @@ seq_test_LDADD = \
 	../htslib/libhts.a \
 	-lboost_unit_test_framework -lboost_system -lboost_timer -lboost_chrono
 
-seq_test_LDFLAGS = --coverage
+seq_test_LDFLAGS = --coverage -pthread
 
 seq_test_SOURCES = seq_test.cpp \
 	../src/BFC.cpp ../src/GenomicRegion.cpp \