Loading .gitignore 0 → 100644 +64 −0 Original line number Diff line number Diff line # Compiled Object files *.o # Compiled Static libraries *.a # Executables src/long_seq_tm_test src/ntdpal src/ntthal src/oligotm src/primer3_core src/primer3_masker src/*.exe # Temporary Test Files test/primer1_list_tmp/* test/primer1_th_list_tmp/* test/primer_list_tmp/* test/th-w-other-tasks_list_tmp/* test/*.err test/*.tmp test/*.tmp2 test/*.valg test/*.vg test/primer_global_err/*.tmp test/primer_global_err/*.tmp2 test/primer_global_err/*.valg test/primer_global_err/*.vg # Individual Test Files test/hyb_probe_only.for test/hyb_probe_only.int test/left_only.for test/pcr_primers.for test/pcr_primers.rev test/pcr_primers_and_io.for test/pcr_primers_and_io.int test/pcr_primers_and_io.rev test/right_only.for test/right_only.rev test/syntax01.for test/syntax01.int test/syntax01.rev test/syntax02.for test/syntax02.int test/syntax02.rev test/syntax03.for test/syntax03.int test/syntax03.rev test/syntax04.for test/syntax04.int test/syntax04.rev test/syntax07.for test/syntax07.int test/syntax07.rev test/syntax09.for test/syntax09.int test/syntax09.rev test/syntax10.for test/syntax10.int test/syntax10.rev .DS_Store COPYING.txt→LICENSE +0 −0 File moved. View file README.md 0 → 100644 +29 −0 Original line number Diff line number Diff line Design PCR primers from DNA sequence. Widely used (190k Google hits for "primer3"). From mispriming libraries to sequence quality data to the generation of internal oligos, primer3 does it. C&perl. Installing ---------- `sudo apt-get install -y build-essential g++ cmake git-all` `git clone https://github.com/primer3-org/primer3.git primer3` `cd primer3/src` `make` `make test` Run Primer3 ----------- `./primer3_core ../example` Read the complete Primer3 manual -------------------------------- [Primer3 Manual](http://primer3.org/primer3_manual.htm) or see /src/primer3_manual.htm create_test_folders.pl 0 → 100755 +74 −0 Original line number Diff line number Diff line #!/usr/bin/perl # ====================================================================== # (c) Copyright 1996,1997,1998,1999,2000,2001,2004,2006,2007,2008,2010, # 2011,2012,2016 # Whitehead Institute for Biomedical Research, Steve Rozen, # Andreas Untergasser and Helen Skaletsky # All rights reserved. # # This file is part of the primer3 suite. # # The primer3 suite is free software; you can redistribute it and/or # modify it under the terms of the GNU General Public License as # published by the Free Software Foundation; either version 2 of the # License, or (at your option) any later version. # # This software is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the # GNU General Public License for more details. # # You should have received a copy of the GNU General Public License # along with this file (file gpl-2.0.txt in the source distribution); if # not, write to the Free Software Foundation, Inc., 51 Franklin St, # Fifth Floor, Boston, MA 02110-1301 USA # # THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS # "AS IS" AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT # LIMITED TO, THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR # A PARTICULAR PURPOSE ARE DISCLAIMED. IN NO EVENT SHALL THE COPYRIGHT # OWNERS OR CONTRIBUTORS BE LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, # SPECIAL, EXEMPLARY, OR CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT # LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, # DATA, OR PROFITS; OR BUSINESS INTERRUPTION) HOWEVER CAUSED AND ON ANY # THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT LIABILITY, OR TORT # (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY OUT OF THE USE # OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF SUCH DAMAGE. # ====================================================================== use warnings 'all'; use strict; if (-d "test") { if (-d "test/primer_list_tmp") { print "Folder excists: test/primer_list_tmp\n"; } else { mkdir "test/primer_list_tmp"; print "Created folder: test/primer_list_tmp\n"; } if (-d "test/primer1_list_tmp") { print "Folder excists: test/primer1_list_tmp\n"; } else { mkdir "test/primer1_list_tmp"; print "Created folder: test/primer1_list_tmp\n"; } if (-d "test/primer1_th_list_tmp") { print "Folder excists: test/primer1_th_list_tmp\n"; } else { mkdir "test/primer1_th_list_tmp"; print "Created folder: test/primer1_th_list_tmp\n"; } if (-d "test/th-w-other-tasks_list_tmp") { print "Folder excists: test/th-w-other-tasks_list_tmp\n"; } else { mkdir "test/th-w-other-tasks_list_tmp"; print "Created folder: test/th-w-other-tasks_list_tmp\n"; } } else { print "Run this script in the Primer3 root folder\n"; } example +7 −11 Original line number Diff line number Diff line SEQUENCE_ID=example SEQUENCE_TEMPLATE=GTAGTCAGTAGACNATGACNACTGACGATGCAGACNACACACACACACACAGCACACAGGTATTAGTGGGCCATTCGATCCCGACCCAAATCGATAGCTACGATGACG SEQUENCE_TARGET=37,21 PRIMER_TASK=pick_detection_primers SEQUENCE_TEMPLATE=tattggtgaagcctcaggtagtgcagaatatgaaacttcaggatccagtgggcatgctactggtagtgctgccggccttacaggcattatggtggcaaagtcgacagagttta PRIMER_TASK=generic PRIMER_PICK_LEFT_PRIMER=1 PRIMER_PICK_INTERNAL_OLIGO=1 PRIMER_PICK_INTERNAL_OLIGO=0 PRIMER_PICK_RIGHT_PRIMER=1 PRIMER_OPT_SIZE=18 PRIMER_MIN_SIZE=15 PRIMER_MAX_SIZE=21 PRIMER_MAX_NS_ACCEPTED=1 PRIMER_PRODUCT_SIZE_RANGE=75-100 P3_FILE_FLAG=1 SEQUENCE_INTERNAL_EXCLUDED_REGION=37,21 PRIMER_OPT_SIZE=20 PRIMER_MIN_SIZE=18 PRIMER_MAX_SIZE=22 PRIMER_PRODUCT_SIZE_RANGE=75-150 PRIMER_EXPLAIN_FLAG=1 = Loading
.gitignore 0 → 100644 +64 −0 Original line number Diff line number Diff line # Compiled Object files *.o # Compiled Static libraries *.a # Executables src/long_seq_tm_test src/ntdpal src/ntthal src/oligotm src/primer3_core src/primer3_masker src/*.exe # Temporary Test Files test/primer1_list_tmp/* test/primer1_th_list_tmp/* test/primer_list_tmp/* test/th-w-other-tasks_list_tmp/* test/*.err test/*.tmp test/*.tmp2 test/*.valg test/*.vg test/primer_global_err/*.tmp test/primer_global_err/*.tmp2 test/primer_global_err/*.valg test/primer_global_err/*.vg # Individual Test Files test/hyb_probe_only.for test/hyb_probe_only.int test/left_only.for test/pcr_primers.for test/pcr_primers.rev test/pcr_primers_and_io.for test/pcr_primers_and_io.int test/pcr_primers_and_io.rev test/right_only.for test/right_only.rev test/syntax01.for test/syntax01.int test/syntax01.rev test/syntax02.for test/syntax02.int test/syntax02.rev test/syntax03.for test/syntax03.int test/syntax03.rev test/syntax04.for test/syntax04.int test/syntax04.rev test/syntax07.for test/syntax07.int test/syntax07.rev test/syntax09.for test/syntax09.int test/syntax09.rev test/syntax10.for test/syntax10.int test/syntax10.rev .DS_Store
README.md 0 → 100644 +29 −0 Original line number Diff line number Diff line Design PCR primers from DNA sequence. Widely used (190k Google hits for "primer3"). From mispriming libraries to sequence quality data to the generation of internal oligos, primer3 does it. C&perl. Installing ---------- `sudo apt-get install -y build-essential g++ cmake git-all` `git clone https://github.com/primer3-org/primer3.git primer3` `cd primer3/src` `make` `make test` Run Primer3 ----------- `./primer3_core ../example` Read the complete Primer3 manual -------------------------------- [Primer3 Manual](http://primer3.org/primer3_manual.htm) or see /src/primer3_manual.htm
create_test_folders.pl 0 → 100755 +74 −0 Original line number Diff line number Diff line #!/usr/bin/perl # ====================================================================== # (c) Copyright 1996,1997,1998,1999,2000,2001,2004,2006,2007,2008,2010, # 2011,2012,2016 # Whitehead Institute for Biomedical Research, Steve Rozen, # Andreas Untergasser and Helen Skaletsky # All rights reserved. # # This file is part of the primer3 suite. # # The primer3 suite is free software; you can redistribute it and/or # modify it under the terms of the GNU General Public License as # published by the Free Software Foundation; either version 2 of the # License, or (at your option) any later version. # # This software is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the # GNU General Public License for more details. # # You should have received a copy of the GNU General Public License # along with this file (file gpl-2.0.txt in the source distribution); if # not, write to the Free Software Foundation, Inc., 51 Franklin St, # Fifth Floor, Boston, MA 02110-1301 USA # # THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS # "AS IS" AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT # LIMITED TO, THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR # A PARTICULAR PURPOSE ARE DISCLAIMED. IN NO EVENT SHALL THE COPYRIGHT # OWNERS OR CONTRIBUTORS BE LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, # SPECIAL, EXEMPLARY, OR CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT # LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, # DATA, OR PROFITS; OR BUSINESS INTERRUPTION) HOWEVER CAUSED AND ON ANY # THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT LIABILITY, OR TORT # (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY OUT OF THE USE # OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF SUCH DAMAGE. # ====================================================================== use warnings 'all'; use strict; if (-d "test") { if (-d "test/primer_list_tmp") { print "Folder excists: test/primer_list_tmp\n"; } else { mkdir "test/primer_list_tmp"; print "Created folder: test/primer_list_tmp\n"; } if (-d "test/primer1_list_tmp") { print "Folder excists: test/primer1_list_tmp\n"; } else { mkdir "test/primer1_list_tmp"; print "Created folder: test/primer1_list_tmp\n"; } if (-d "test/primer1_th_list_tmp") { print "Folder excists: test/primer1_th_list_tmp\n"; } else { mkdir "test/primer1_th_list_tmp"; print "Created folder: test/primer1_th_list_tmp\n"; } if (-d "test/th-w-other-tasks_list_tmp") { print "Folder excists: test/th-w-other-tasks_list_tmp\n"; } else { mkdir "test/th-w-other-tasks_list_tmp"; print "Created folder: test/th-w-other-tasks_list_tmp\n"; } } else { print "Run this script in the Primer3 root folder\n"; }
example +7 −11 Original line number Diff line number Diff line SEQUENCE_ID=example SEQUENCE_TEMPLATE=GTAGTCAGTAGACNATGACNACTGACGATGCAGACNACACACACACACACAGCACACAGGTATTAGTGGGCCATTCGATCCCGACCCAAATCGATAGCTACGATGACG SEQUENCE_TARGET=37,21 PRIMER_TASK=pick_detection_primers SEQUENCE_TEMPLATE=tattggtgaagcctcaggtagtgcagaatatgaaacttcaggatccagtgggcatgctactggtagtgctgccggccttacaggcattatggtggcaaagtcgacagagttta PRIMER_TASK=generic PRIMER_PICK_LEFT_PRIMER=1 PRIMER_PICK_INTERNAL_OLIGO=1 PRIMER_PICK_INTERNAL_OLIGO=0 PRIMER_PICK_RIGHT_PRIMER=1 PRIMER_OPT_SIZE=18 PRIMER_MIN_SIZE=15 PRIMER_MAX_SIZE=21 PRIMER_MAX_NS_ACCEPTED=1 PRIMER_PRODUCT_SIZE_RANGE=75-100 P3_FILE_FLAG=1 SEQUENCE_INTERNAL_EXCLUDED_REGION=37,21 PRIMER_OPT_SIZE=20 PRIMER_MIN_SIZE=18 PRIMER_MAX_SIZE=22 PRIMER_PRODUCT_SIZE_RANGE=75-150 PRIMER_EXPLAIN_FLAG=1 =