New upstream version 2019.10.0 (043a6cd7) · Commits · Debian Med / q2-types

ci/recipe/meta.yaml

+2 −0

Original line number	Diff line number	Diff line
		@@ -25,6 +25,8 @@ requirements:
		- biom-format >=2.1.5,<2.2.0
		- ijson
		- h5py
		- matplotlib 3.1.0
		- matplotlib-base 3.1.0
		- qiime2 {{ release }}.*

		test:

q2_types/_version.py

+3 −3

Original line number	Diff line number	Diff line
		@@ -23,9 +23,9 @@ def get_keywords():
		# setup.py/versioneer.py will grep for the variable names, so they must
		# each be defined on a line of their own. _version.py will just call
		# get_keywords().
		git_refnames = " (tag: 2019.7.0)"
		git_full = "9f31de0c81510fbe6be8b16f95e23b4c974ca002"
		git_date = "2019-07-30 18:15:54 +0000"
		git_refnames = " (tag: 2019.10.0)"
		git_full = "b382dd345500fc2172858ff00638e6bca35760ed"
		git_date = "2019-11-01 01:04:25 +0000"
		keywords = {"refnames": git_refnames, "full": git_full, "date": git_date}
		return keywords

q2_types/feature_data/_format.py

+52 −27

Original line number	Diff line number	Diff line
		@@ -54,9 +54,6 @@ class TaxonomyFormat(model.TextFileFormat):
		elif line.lstrip(' ') == '\n':
		# Blank line
		continue
		elif line.startswith('#'):
		# Comment line
		continue
		else:
		cells = line.split('\t')
		if len(cells) < 2:
		@@ -93,41 +90,53 @@ class TSVTaxonomyFormat(model.TextFileFormat):

		Optionally followed by other arbitrary columns.

		This format supports comment lines starting with #, and blank lines. The
		expected header must be the first non-comment, non-blank line. In addition
		to the header, there must be at least one line of data.
		This format supports blank lines. The expected header must be the first
		non-blank line. In addition to the header, there must be at least one line
		of data.

		"""
		HEADER = ['Feature ID', 'Taxon']

		def sniff(self):
		def _check_n_records(self, n=None):
		with self.open() as fh:
		data_lines = 0
		data_line_count = 0
		header = None
		while data_lines < 10:
		line = fh.readline()

		if line == '':
		# EOF
		break
		elif line.lstrip(' ') == '\n':
		file_ = enumerate(fh) if n is None else zip(range(n), fh)

		for i, line in file_:
		# Tracks line number for error reporting
		i = i + 1

		if line.lstrip(' ') == '\n':
		# Blank line
		continue
		elif line.startswith('#'):
		# Comment line
		continue

		cells = line.rstrip('\n').split('\t')
		cells = line.strip('\n').split('\t')

		if header is None:
		if cells[:2] != self.HEADER:
		return False
		raise ValidationError(
		'%s must be the first two header values. The '
		'first two header values provided are: %s (on '
		'line %s).' % (self.HEADER, cells[:2], i))
		header = cells
		else:
		if len(cells) != len(header):
		return False
		data_lines += 1
		raise ValidationError(
		'Number of values on line %s are not the same as '
		'number of header values. Found %s values '
		'(%s), expected %s.' % (i, len(cells), cells,
		len(self.HEADER)))

		data_line_count += 1

		return header is not None and data_lines > 0
		if data_line_count == 0:
		raise ValidationError('No taxonomy records found, only blank '
		'lines and/or a header row.')

		def _validate_(self, level):
		self._check_n_records(n={'min': 10, 'max': None}[level])


		TSVTaxonomyDirectoryFormat = model.SingleFileDirectoryFormat(
		@@ -138,6 +147,7 @@ class DNAFASTAFormat(model.TextFileFormat):
		def _validate_lines(self, max_lines):
		FASTADNAValidator = re.compile(r'[ACGTURYKMSWBDHVN]+\r?\n?')
		last_line_was_ID = False
		ids = {}

		with open(str(self), 'rb') as fh:
		try:
		@@ -149,8 +159,8 @@ class DNAFASTAFormat(model.TextFileFormat):
		return
		if first[0] != ord(b'>'):
		raise ValidationError("First line of file is not a valid "
		"FASTA ID. FASTA IDs must start "
		"with '>'")
		"description. Descriptions must "
		"start with '>'")
		fh.seek(0)
		for line_number, line in enumerate(fh, 1):
		if line_number >= max_lines:
		@@ -158,9 +168,24 @@ class DNAFASTAFormat(model.TextFileFormat):
		line = line.decode('utf-8-sig')
		if line.startswith('>'):
		if last_line_was_ID:
		raise ValidationError('Multiple consecutive IDs '
		'starting on line '
		f'{line_number-1!r}')
		raise ValidationError('Multiple consecutive '
		'descriptions starting on '
		f'line {line_number-1!r}')
		line = line.split()
		if line[0] == '>':
		if len(line) == 1:
		raise ValidationError(
		f'Description on line {line_number} is '
		'missing an ID.')
		else:
		raise ValidationError(
		f'ID on line {line_number} starts with a '
		'space. IDs may not start with spaces')
		if line[0] in ids:
		raise ValidationError(
		f'ID on line {line_number} is a duplicate of '
		f'another ID on line {ids[line[0]]}.')
		ids[line[0]] = line_number
		last_line_was_ID = True
		elif re.fullmatch(FASTADNAValidator, line):
		last_line_was_ID = False

q2_types/feature_data/_transformer.py

+2 −1

Original line number	Diff line number	Diff line
		@@ -47,7 +47,7 @@ def _taxonomy_formats_to_dataframe(filepath, has_header=None):
		"""
		# Using `dtype=object` and `set_index()` to avoid type casting/inference of
		# any columns or the index.
		df = pd.read_csv(filepath, sep='\t', comment='#', skip_blank_lines=True,
		df = pd.read_csv(filepath, sep='\t', skip_blank_lines=True,
		header=None, dtype=object)

		if len(df.columns) < 2:
		@@ -88,6 +88,7 @@ def _taxonomy_formats_to_dataframe(filepath, has_header=None):
		"column names are duplicated: %s" %
		', '.join(df.columns.get_duplicates()))

		df['Taxon'] = df['Taxon'].str.strip()
		return df

q2_types/feature_data/tests/data/dna-sequences-duplicate-id.fasta

0 → 100644

+5 −0

Original line number	Diff line number	Diff line
		>SEQUENCE1
		ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT
		>SEQUENCE1
		ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT
		ACGTACGTACGTACGTACGTACGT