.gitignore

@@ -5,6 +5,8 @@ __pycache__/
 # C extensions
 *.so
 
+#atom files
+*.nfs*
 # Distribution / packaging
 .Python
 env/

.travis.yml

+language: python
+
+matrix:
+  include:
+    - os: linux
+      dist: trusty
+      sudo: required
+      python: 2.7
+      before_install: "sudo apt-get install -y -f python python-dev python-pip pkg-config python-wxgtk2.8 libpng-dev libjpeg8-dev libfreetype6-dev"
+      install: "pip install --upgrade pip setuptools numpy scipy pillow matplotlib pytest"
+
+DISPLAY: 0.0
+notifications:
+  email:
+    on_success: change # default: change
+    on_failure: change # default: always
+before_script: cd /home/travis/build/mad-lab/transit/tests
+script: travis_wait 30 pytest

CHANGELOG.md

@@ -2,6 +2,25 @@
 All notable changes to this project will be documented in this file.
 
 
+
+## Version 2.1.0 - 2017-06-23
+- TRANSIT:
+    - Added tooltips next to most parameters to explain their functionality.
+    - Added Quality Control window, with choice for normalization method.
+    - Added more normalization options to the HMM method.
+    - Added LOESS correction functionality back to TRANSIT
+    - Added ability to scale Track View based on mean-count of the window.
+    - Added ability to scale individual tracks in Track View.
+    - Added ability to add tracks of features to Track View.
+    - New documentation on normalization.
+
+- TPP:
+    - TPP can now accept empty primer prefix (in case reads have been trimmed).
+    - TPP can now process reads obtained using Mme1 enzyme and protocol.
+    - TPP can now pass flags to BWA.
+
+
+
 ## Version 2.0.2 - 2016-08-19
     
 - TRANSIT:

README.md

-# TRANSIT 2.0
 
 
-**New in Version 2.0+**
- - Support for Tn5 datasets.
- - New analysis methods.
- - New way to export normalized datasets.
+
+# TRANSIT 2.1.0
+
+
+[![Build Status](https://travis-ci.org/mad-lab/transit.svg?branch=master)](https://travis-ci.org/mad-lab/transit)   [![Documentation Status](https://readthedocs.org/projects/transit/badge/?version=latest)](http://transit.readthedocs.io/en/latest/?badge=latest) 
+
+
+
+**Version 2.1.0 changes (June, 20017)**
+- Added tooltips next to most parameters to explain their functionality.
+- Added Quality Control window, with choice for normalization method.
+- Added more normalization options to the HMM method.
+- Added LOESS correction functionality back to TRANSIT
+- Added ability to scale Track View based on mean-count of the window.
+- Added ability to scale individual tracks in Track View.
+- Added ability to add tracks of features to Track View.
+- Better status messages for TrackView
+- TPP can now accept empty primer prefix (in case reads have been trimmed).
+- TPP can now process reads obtained using Mme1 enzyme and protocol.
+- TPP can now pass flags to BWA.
+- Lots of bug fixes.
+
+
 
 **Version 2.0.2 changes (August, 2016)**
 - Added support for for custom primers in TPP.
@@ -14,6 +32,12 @@
 - **New [mailing list](https://groups.google.com/forum/#!forum/tnseq-transit/join)**
 
 
+**New in Version 2.0+**
+ - Support for Tn5 datasets.
+ - New analysis methods.
+ - New way to export normalized datasets.
+
+
 
 Welcome! This is the distribution for the TRANSIT and TPP tools developed by the Ioerger Lab.
 

VERSION

-version: 2.0.1-58-g0a3b-mod
+version: 2.1.0-18-g4192-mod

debian/changelog

+tnseq-transit (2.1.1-1) unstable; urgency=medium
+
+  * New upstream version
+  * Standards-Version: 4.1.3
+  * debhelper 11
+  * d/rules: do not parse d/changelog
+
+ -- Andreas Tille <tille@debian.org>  Mon, 19 Feb 2018 11:40:06 +0100
+
 tnseq-transit (2.0.2-1) unstable; urgency=medium
 
   * Initial release (Closes: #856661)

debian/compat

-10
+11

debian/control

@@ -3,10 +3,10 @@ Maintainer: Debian Med Packaging Team <debian-med-packaging@lists.alioth.debian.
 Uploaders: Andreas Tille <tille@debian.org>
 Section: science
 Priority: optional
-Build-Depends: debhelper (>= 10),
+Build-Depends: debhelper (>= 11~),
                python-all-dev,
                python-setuptools
-Standards-Version: 3.9.8
+Standards-Version: 4.1.3
 Vcs-Browser: https://anonscm.debian.org/cgit/debian-med/tnseq-transit.git
 Vcs-Git: https://anonscm.debian.org/git/debian-med/tnseq-transit.git
 Homepage: http://pythonhosted.org/tnseq-transit/transit_overview.html
@@ -20,9 +20,9 @@ Depends: ${python:Depends},
          python-pillow,
          python-matplotlib,
          python-wxgtk3.0
+Breaks: transit
 Provides: transit
 Replaces: transit
-Breaks: transit
 Description: statistical calculations of essentiality of genes or genomic regions
  This is a software that can be used to analyze Tn-Seq datasets. It
  includes various statistical calculations of essentiality of genes or

debian/rules

@@ -3,11 +3,11 @@
 # DH_VERBOSE := 1
 export LC_ALL=C.UTF-8
 
-DEBPKGNAME     := $(shell dpkg-parsechangelog | awk '/^Source:/ {print $$2}')
+include /usr/share/dpkg/default.mk
 
 %:
 	dh $@ --with python2
 
 override_dh_install:
 	dh_install
-	mv debian/$(DEBPKGNAME)/usr/bin/tpp debian/$(DEBPKGNAME)/usr/bin/transit-tpp
+	mv debian/$(DEB_SOURCE)/usr/bin/tpp debian/$(DEB_SOURCE)/usr/bin/transit-tpp

setup.py

@@ -78,7 +78,7 @@ setup(
     # your project is installed. For an analysis of "install_requires" vs pip's
     # requirements files see:
     # https://packaging.python.org/en/latest/requirements.html
-    install_requires=['setuptools', 'numpy', 'scipy', 'pillow', 'matplotlib>1.2.0,<1.5.0'],
+    install_requires=['setuptools', 'numpy', 'scipy', 'pillow', 'matplotlib'],
     
     #dependency_links = [
     #	"git+https://github.com/wxWidgets/wxPython.git#egg=wxPython"

src/pytpp/__main__.py

@@ -34,13 +34,11 @@ from tpp_tools import *
 from tpp_gui import *
 
 
-def main():
-    # if -nowin is command-line arg, skip the GUI and set filenames in vars
+def main(arguments=[]):
 
     vars = Globals()
-    #vars.version = "$Revision: 1.5 $".split()[1]
 
-    if len(sys.argv) <= 1 and hasWx:
+    if len(arguments) <= 1 and hasWx:
         app = wx.App(False)
         form = MyForm(vars)
         form.update_dataset_list()
@@ -57,70 +55,59 @@ def main():
                 else: msg = 'running pre-processing on %s and %s' % (vars.fq1,vars.fq2)
                 message(msg)
                 message("transposon type: %s" % vars.transposon)
+                message("protocol: %s" % vars.protocol)
                 save_config(vars)
                 driver(vars)
 
         else:
             pass
 
-    elif len(sys.argv) <= 1 and not hasWx:
+    elif len(arguments) <= 1 and not hasWx:
         print "Please install wxPython to run in GUI Mode."
         print "To run in Console Mode please follow these instructions:"
         print ""
         show_help()
 
     else:
-        flag = False
-        initialize_globals(vars)
-        i,n = 1,len(sys.argv)
-        while i<n:
-            if sys.argv[i] == '-help':
+        (args, kwargs) = cleanargs(arguments)
+
+        # Show help if needed
+        if "help" in kwargs or "-help" in kwargs:
             show_help()
             sys.exit()
-            elif sys.argv[i] == '-tn5':
-                vars.transposon = 'Tn5'
-                i += 1
-            elif sys.argv[i] == '-himar1': 
-                vars.transposon = 'Himar1'
-                i += 1
-            elif sys.argv[i] == '-primer': 
-                vars.prefix = sys.argv[i+1]
-                i += 2
-            elif sys.argv[i] == '-reads1':
-                vars.fq1 = sys.argv[i+1]
-                i += 2
-            elif sys.argv[i] == '-reads2':
-                flag = True
-                vars.fq2 = sys.argv[i+1]
-                i += 2
-            elif sys.argv[i] == '-bwa':
-                vars.bwa = sys.argv[i+1]
-                i += 2
-            elif sys.argv[i] == '-ref':
-                vars.ref = sys.argv[i+1]
-                i += 2
-            elif sys.argv[i] == '-maxreads':
-                vars.maxreads = int(sys.argv[i+1])
-                i += 2
-            elif sys.argv[i] == '-output':
-                vars.base = sys.argv[i+1]
-                i += 2
-            elif sys.argv[i] == '-mismatches':
-                vars.mm1 = int(sys.argv[i+1])
-                i += 2
-            else:
-                print "error: unrecognized flag:",sys.argv[i]
+
+        # Check for strange flags
+        known_flags = set(["tn5", "help", "himar1", "protocol", "primer", "reads1",
+                           "reads2", "bwa", "ref", "maxreads", "output", "mismatches", "flags"])
+        unknown_flags = set(kwargs.keys()) - known_flags
+        if unknown_flags:
+            print "error: unrecognized flags:", ", ".join(unknown_flags)
             show_help()
             sys.exit()
-        if flag==False: vars.fq2 = ""
-        if vars.fq2=="": msg = 'running pre-processing on %s' % (vars.fq1)
-        else: msg = 'running pre-processing on %s and %s' % (vars.fq1,vars.fq2)
+
+        # Initialize variables
+        initialize_globals(vars, args, kwargs)
+
+        # Check inputs make sense
+        verify_inputs(vars)
+        
+        # Print some messages
+        if vars.fq2:
+            msg = 'running pre-processing on %s' % (vars.fq1)
+        else:
+            msg = 'running pre-processing on %s and %s' % (vars.fq1, vars.fq2)
+
         message(msg)
+        message("protocol: %s" % vars.protocol)
         message("transposon type: %s" % vars.transposon)
-        verify_inputs(vars)
+
+        # Save configuration file
         save_config(vars)
+        
+        # Run TPP
         driver(vars)
 
+
 if __name__ == "__main__":
-    main()
+    main(sys.argv[1:])
 

src/pytpp/tpp_tools.py

@@ -26,6 +26,23 @@ import platform
 import gzip
 import subprocess
 
+def cleanargs(rawargs):
+    #TODO: Write docstring
+    args = []
+    kwargs = {}
+    count = 0
+    while count < len(rawargs):
+        if rawargs[count].startswith("-"): #and len(rawargs[count].split(" ")) == 1:
+            if count + 1 < len(rawargs) and (not rawargs[count+1].startswith("-") or len(rawargs[count+1].split(" ")) > 1):
+                kwargs[rawargs[count][1:]] = rawargs[count+1]
+                count += 1
+            else:
+                kwargs[rawargs[count][1:]] = True
+        else:
+            args.append(rawargs[count])
+        count += 1
+    return (args, kwargs)
+
 
 
 def analyze_dataset(wigfile):
@@ -76,8 +93,8 @@ def fastq2reads(infile,outfile,maxreads):
 def fix_paired_headers_for_bwa(reads1,reads2):
   a = open(reads1)
   b = open(reads2)
-  temp1 = "temp."+reads1
-  temp2 = "temp."+reads2
+  temp1 = reads1+".temp"
+  temp2 = reads2+".temp"
   c = open(temp1,"w")
   d = open(temp2,"w")
   tot = 0
@@ -126,7 +143,11 @@ def fix_paired_headers_for_bwa(reads1,reads2):
 	  os.system("mv %s %s" % (temp2, reads2))
   '''
 
+# find index of H[1..m] in G[1..n] with up to max mismatches
+
 def mmfind(G,n,H,m,max): # lengths; assume n>m
+  a = G[:n].find(H[:m])
+  if a!=-1: return a # shortcut for perfect matches
   for i in range(0,n-m):
     cnt = 0
     for k in range(m):
@@ -149,8 +170,11 @@ def extract_staggered(infile,outfile,vars):
   vars.truncated_reads = 0
   output = open(outfile,"w")
   tot = 0
+  #print infile
   for line in open(infile):
+    #print line
     line = line.rstrip()
+    if not line: continue
     if line[0]=='>': header = line; continue
     tot += 1
     if tot%1000000==0: message("%s reads processed" % tot)
@@ -160,7 +184,8 @@ def extract_staggered(infile,outfile,vars):
     if a>=P and a<=Q:
       gstart,gend = a+lenTn,readlen
       if b!=-1: gend = b; vars.truncated_reads += 1
-      if gend-gstart<20: continue # too short
+      #if gend-gstart<20: continue # too short
+      if gend-gstart<5: continue # too short
       output.write(header+"\n")
       output.write(line[gstart:gend]+"\n")
       vars.tot_tgtta += 1
@@ -314,7 +339,7 @@ def template_counts(ref,sam,bcfile,vars):
 
   sites = []
   for i in range(len(genome)-1):
-    if genome[i:i+2]=="TA":
+    if genome[i:i+2].upper()=="TA":
       pos = i+1
       h = hits.get(pos,[])
       f = filter(lambda x: x[0]=='F',h)
@@ -335,8 +360,25 @@ def template_counts(ref,sam,bcfile,vars):
 
 # pretend that all reads count as unique templates
 
+def increase_counts(pos,sites, strand):
+        if strand == "F":
+            sites[pos][1] += 1  #if read has been found before, tally 1 more in R reads
+            sites[pos][2] += 1  #if read has been found before, tally 1 more in R reads
+        if strand == "R":
+            sites[pos][3] += 1  #if read has been found before, tally 1 more in R reads
+            sites[pos][4] += 1  #if read has been found before, tally 1 more in R reads
+        sites[pos][5] += 1  #if read has been found before, tally 1 more in R reads
+        sites[pos][6] += 1  #if read has been found before, tally 1 more in R reads
+    
+
 def read_counts(ref,sam,vars):
     genome = read_genome(ref)
+    sites = {}
+    for i in range(len(genome)-1):
+        if genome[i:i+2]=="TA" or vars.transposon=='Tn5':
+          pos = i+1
+          sites[pos] = [pos,0,0,0,0,0,0]
+     
     hits = {}
     vars.tot_tgtta,vars.mapped = 0,0
     vars.r1 = vars.r2 = 0
@@ -351,28 +393,34 @@ def read_counts(ref,sam,vars):
                 vars.mapped += 1
                 readlen = len(w[9])
                 pos = int(w[3])
+                if vars.protocol.lower() == "mme1":
+                    strand,delta = 'F',readlen
+                    if code[4]=="1": strand,delta = 'R',1
+                    site1 = pos + delta - 2 #if on + strand, take column 3 position and add 1bp,
+                    site2 = pos + delta - 1 #check one off just in case it enzyme chewed too much
+                    if site1 in sites:
+                        increase_counts(site1, sites, strand)
+                    if site2 in sites:
+                        increase_counts(site2, sites, strand)
+                else:
                     strand,delta = 'F',-2
                     if code[4]=="1": strand,delta = 'R',readlen
-        pos += delta
-        if pos not in hits: hits[pos] = []
-        hits[pos].append(strand)
+                    site1 = pos + delta #if on + strand, take column 3 position and add 1bp)
+                    if site1 in sites:
+                        increase_counts(site1, sites, strand)
+    
+    results = []
+    for key in sorted(sites.keys()):
+        results.append(sites[key])
+    return results # (coord, Fwd_Rd_Ct, Fwd_Templ_Ct, Rev_Rd_Ct, Rev_Templ_Ct, Tot_Rd_Ct, Tot_Templ_Ct)
 
-  sites = []
-  for i in range(len(genome)-1):
-    if genome[i:i+2]=="TA" or vars.transposon=='Tn5':
-      pos = i+1
-      h = hits.get(pos,[])
-      lenf,lenr = h.count('F'),h.count('R')
-      data = [pos,lenf,lenf,lenr,lenr,lenf+lenr,lenf+lenr]
-      sites.append(data)
 
-  return sites # (coord, Fwd_Rd_Ct, Fwd_Templ_Ct, Rev_Rd_Ct, Rev_Templ_Ct, Tot_Rd_Ct, Tot_Templ_Ct)
 
 def driver(vars):
   vars.reads1 = vars.base+".reads1"
   vars.reads2 = vars.base+".reads2"
-  vars.tgtta1 = vars.base+".tgtta1"
-  vars.tgtta2 = vars.base+".tgtta2"
+  vars.trimmed1 = vars.base+".trimmed1"
+  vars.trimmed2 = vars.base+".trimmed2"
   vars.barcodes1 = vars.base+".barcodes1"
   vars.barcodes2 = vars.base+".barcodes2"
   vars.genomic2 = vars.base+".genomic2"
@@ -383,9 +431,10 @@ def driver(vars):
   vars.wig = vars.base+".wig"
   vars.stats = vars.base+".tn_stats"
 
-  if vars.prefix==None:
+  if not vars.prefix:
     if vars.transposon=="Tn5": vars.prefix = "TAAGAGACAG"
     elif vars.transposon=="Himar1": vars.prefix = "ACTTATCAGCCAACCTGTTA"
+    else: vars.prefix = ""
 
   try:
      extract_reads(vars)
@@ -446,8 +495,8 @@ def extract_reads(vars):
 
     if vars.single_end==True:
       message("assuming single-ended reads")
-      message("creating %s" % vars.tgtta1)
-      extract_staggered(vars.reads1,vars.tgtta1,vars)
+      message("creating %s" % vars.trimmed1)
+      extract_staggered(vars.reads1,vars.trimmed1,vars)
 
       return 
 
@@ -462,23 +511,23 @@ def extract_reads(vars):
 
     message("extracting barcodes and genomic parts of reads...")
 
-    message("creating %s" % vars.tgtta1)
-    extract_staggered(vars.reads1,vars.tgtta1,vars)
+    message("creating %s" % vars.trimmed1)
+    extract_staggered(vars.reads1,vars.trimmed1,vars)
 
-    message("creating %s" % vars.tgtta2)
-    select_reads(vars.tgtta1,vars.reads2,vars.tgtta2)
+    message("creating %s" % vars.trimmed2)
+    select_reads(vars.trimmed1,vars.reads2,vars.trimmed2)
     #message("creating %s" % vars.barcodes2)
-    #select_cycles(vars.tgtta2,22,30,vars.barcodes2)
+    #select_cycles(vars.trimmed2,22,30,vars.barcodes2)
     #message("creating %s" % vars.genomic2)
-    #select_cycles(vars.tgtta2,43,-1,vars.genomic2)
+    #select_cycles(vars.trimmed2,43,-1,vars.genomic2)
 
     # instead of using select_cycles, do these both in one shot by looking for constant seqs
     message("creating %s" % vars.barcodes2)
     message("creating %s" % vars.genomic2)
-    extract_barcodes(vars.tgtta2,vars.barcodes2,vars.genomic2, vars.mm1)
+    extract_barcodes(vars.trimmed2,vars.barcodes2,vars.genomic2, vars.mm1)
 
     message("creating %s" % vars.barcodes1)
-    replace_ids(vars.tgtta1,vars.barcodes2,vars.barcodes1)
+    replace_ids(vars.trimmed1,vars.barcodes2,vars.barcodes1)
 
 #  pattern for read 2...
 #    TAGTGGATGATGGCCGGTGGATTTGTG GTAATTACCA TGGTCGTGGTAT CCCAGCGCGACTTCTTCGGCGCACACACC TAACAGGTTGGCTGATAAGTCCCCG?AGAT AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGT
@@ -548,6 +597,8 @@ def bwa_subprocess(command, outfile):
     for line in iter(process.stderr.readline, ''):
         if "Permission denied" in line:
             raise IOError("Error: BWA encountered a permissions error: \n\n%s" % line)
+        if "invalid option" in line:
+            raise ValueError("Error: Unrecognized flag for BWA: %s" % (line.split()[-1]))
         sys.stderr.write("%s\n" % line.strip())
 
 
@@ -561,22 +612,29 @@ def run_bwa(vars):
       bwa_subprocess(cmd, sys.stdout)
        
 
-    cmd = [vars.bwa, "aln",  vars.ref, vars.tgtta1]
+    cmd = [vars.bwa, "aln"]
+    if vars.flags.strip():
+        cmd.extend( vars.flags.split(" "))
+    cmd.extend([vars.ref, vars.trimmed1])
     outfile = open(vars.sai1, "w")
     bwa_subprocess(cmd, outfile)
 
 
     if vars.single_end==True:
-      cmd = [vars.bwa, "samse", vars.ref, vars.sai1, vars.tgtta1]
+        cmd = [vars.bwa, "samse", vars.ref, vars.sai1, vars.trimmed1]
         outfile = open(vars.sam, "w")
         bwa_subprocess(cmd, outfile)
 
     else:
-      cmd = [vars.bwa, "aln", vars.ref, vars.genomic2]
+     
+        cmd = [vars.bwa, "aln"]
+        if vars.flags.strip():
+            cmd.extend(vars.flags.split(" "))
+        cmd.extend([vars.ref, vars.genomic2])
         outfile = open(vars.sai2, "w")
         bwa_subprocess(cmd, outfile)
 
-      cmd = [vars.bwa, "sampe", vars.ref, vars.sai1, vars.sai2, vars.tgtta1, vars.genomic2]
+        cmd = [vars.bwa, "sampe", vars.ref, vars.sai1, vars.sai2, vars.trimmed1, vars.genomic2]
         outfile = open(vars.sam, "w")
         bwa_subprocess(cmd, outfile)
 
@@ -667,7 +725,7 @@ def generate_output(vars):
   rcounts = [x[5] for x in counts]
   tcounts = [x[6] for x in counts]
   rc,tc = sum(rcounts),sum(tcounts)
-  ratio = rc/float(tc)
+  ratio = rc/float(tc) if (rc != 0 and tc !=0) else 0
   ta_sites = len(rcounts)
   tas_hit = len(filter(lambda x: x>0,rcounts))
   density = tas_hit/float(ta_sites)
@@ -687,7 +745,7 @@ def generate_output(vars):
  
 
   read_length = get_read_length(vars.base + ".reads1")
-  mean_r1_genomic = get_genomic_portion(vars.base + ".tgtta1")
+  mean_r1_genomic = get_genomic_portion(vars.base + ".trimmed1")
   if vars.single_end==False: mean_r2_genomic = get_genomic_portion(vars.base + ".genomic2")
 
   output = open(vars.stats,"w")
@@ -698,12 +756,14 @@ def generate_output(vars):
   output.write("# command: python ")
   output.write(' '.join(sys.argv)+"\n")
   output.write('# transposon type: %s\n' % vars.transposon)
+  output.write('# protocol type: %s\n' % vars.protocol)
+  output.write('# bwa flags: %s\n' % vars.flags)
   output.write('# read1: %s\n' % vars.fq1)
   output.write('# read2: %s\n' % vars.fq2)
   output.write('# ref_genome: %s\n' % vars.ref)
   output.write("# total_reads %s (or read pairs)\n" % tot_reads)
   #output.write("# truncated_reads %s (fragments shorter than the read length; ADAP2 appears in read1)\n" % vars.truncated_reads)
-  output.write("# TGTTA_reads %s (reads with valid Tn prefix, and insert size>20bp)\n" % vars.tot_tgtta)
+  output.write("# trimmed_reads %s (reads with valid Tn prefix, and insert size>20bp)\n" % vars.tot_tgtta)
   output.write("# reads1_mapped %s\n" % vars.r1)
   output.write("# reads2_mapped %s\n" % vars.r2)
   output.write("# mapped_reads %s (both R1 and R2 map into genome)\n" % vars.mapped)
@@ -746,22 +806,140 @@ def error(s):
   print "error:",s
   sys.exit(0)
 
+def warning(s):
+  print "warning:",s
+
+
+
+
+
+def set_defaults(vars, protocol):
+    #protocol = kwargs.get("protocol", "sassetti")
+    if protocol == "sassetti":
+        set_sassetti_defaults(vars)
+    elif protocol == "mme1":
+        set_mme1_defaults(vars)
+    elif protocol == "tn5":
+        set_tn5_defaults(vars)
+    else:
+        set_sassetti_defaults(vars)
+
+def set_attributes(vars, attributes_list, override=False):
+    for (attr, value) in attributes_list:
+        if override:
+            setattr(vars, attr, value)
+        else:
+            if not hasattr(vars, attr):
+                setattr(vars, attr, value)
+            
+
+def set_sassetti_defaults(vars):
+    attributes_list = []
+    attributes_list.append(("transposon", "Himar1"))
+    attributes_list.append(("protocol", "Sassetti"))
+    attributes_list.append(("prefix", "ACTTATCAGCCAACCTGTTA"))
+    attributes_list.append(("maxreads", -1))
+    attributes_list.append(("mm1", 100))
+    set_attributes(vars, attributes_list)
+
+
+def set_mme1_defaults(vars):
+    attributes_list = []
+    attributes_list.append(("transposon", "Himar1"))
+    attributes_list.append(("protocol", "Mme1"))
+    attributes_list.append(("prefix", ""))
+    attributes_list.append(("maxreads", -1))
+    attributes_list.append(("mm1", 2))
+    set_attributes(vars, attributes_list)
+
+
+def set_tn5_defaults(vars):
+    attributes_list = []
+    attributes_list.append(("transposon", "Tn5"))
+    attributes_list.append(("protocol", "Tn5"))
+    attributes_list.append(("prefix", ""))
+    attributes_list.append(("maxreads", -1))
+    attributes_list.append(("mm1", 2))
+    set_attributes(vars, attributes_list)
+
+
+
+
 def verify_inputs(vars):
-  if not os.path.exists(vars.fq1): error("file not found: "+vars.fq1)
+  
+    if not os.path.exists(vars.fq1): error("reads1 file not found: "+vars.fq1)
     vars.single_end = False
     if vars.fq2=="": vars.single_end = True
-  elif not os.path.exists(vars.fq2): error("file not found: "+vars.fq2)
-  if not os.path.exists(vars.ref): error("file not found: "+vars.ref)
+    elif not os.path.exists(vars.fq2): error("reads2 file not found: "+vars.fq2)
+    if not os.path.exists(vars.ref): error("reference file not found: "+vars.ref)
     if vars.base == '': error("prefix cannot be empty")
     if vars.fq1 == vars.fq2: error('fastq files cannot be identical')
 
-def initialize_globals(vars):
+    # If Mme1 protocol, warn that we don't use read2 file
+    if vars.protocol.lower() == "mme1" and not vars.single_end:
+        warning("Ignoring Read 2 file. TPP assumes Mme1 protocol runs in single-end mode.")
+        vars.single_end = True
+        vars.fq2 = ""
+
+    if os.path.isdir(vars.bwa):
+        bwaexec_unix = os.path.join(vars.bwa, "bwa")
+        bwaexec_win = os.path.join(vars.bwa, "bwa.exe")
+        if os.path.exists(bwaexec_unix) and not os.path.isdir(bwaexec_unix):
+            warning("did not include BWA executable name. Assuming BWA executable is named 'bwa'")
+            vars.bwa = bwaexec_unix
+        elif os.path.exists(bwaexec_win) and not os.path.isdir(bwaexec_win):
+            warning("did not include BWA executable name. Assuming BWA executable is named 'bwa.exe'")
+            vars.bwa = bwaexec_win
+        else:
+            error('cannot find BWA executable. Please include the full executable name as well as its directory.')
+    elif not os.path.exists(vars.bwa):
+        error('cannot find BWA executable. Please include the full executable name as well as its directory.')
+
+def initialize_globals(vars, args=[], kwargs={}):
     vars.fq1,vars.fq2,vars.ref,vars.bwa,vars.base,vars.maxreads = "","","","","temp",-1
     vars.mm1 = 1 # mismatches allowed in Tn prefix
     vars.transposon = 'Himar1'
-      vars.prefix = None
+    vars.protocol = "Sassetti"
+    vars.prefix = "ACTTATCAGCCAACCTGTTA"
+    vars.flags = ""
+   
+    # Update defaults
+    protocol = kwargs.get("protocol", "").lower()
+    if protocol:
+        set_protocol_defaults(vars, protocol)
+    elif not kwargs:
         read_config(vars)
 
+    # If running in console mode with flags
+    if "protocol" in kwargs:
+        vars.protocol = kwargs["protocol"]
+    if "himar1" in kwargs:
+        vars.transposon = "Himar1"
+    if "tn5" in kwargs:
+        vars.transposon = "Tn5"
+    if "protocol" in kwargs:
+        vars.protocol = kwargs["protocol"]
+    if "primer" in kwargs:
+        vars.prefix = kwargs["primer"]
+    if "reads1" in kwargs:
+        vars.fq1 = kwargs["reads1"]
+    if "reads2" in kwargs:
+        vars.fq2 = kwargs["reads2"]
+    if "bwa" in kwargs:
+        vars.bwa = kwargs["bwa"]
+    if "ref" in kwargs:
+        vars.ref = kwargs["ref"]
+    if "maxreads" in kwargs:
+        vars.maxreads = int(kwargs["maxreads"])
+    if "output" in kwargs:
+        vars.base = kwargs["output"]
+    if "mismatches" in kwargs:
+        vars.mm1 = int(kwargs["mismatches"])
+    if "flags" in kwargs:
+        vars.flags = kwargs["flags"]
+
+
+
 def read_config(vars):
   if not os.path.exists("tpp.cfg"): return
   for line in open("tpp.cfg"):
@@ -773,6 +951,10 @@ def read_config(vars):
     if len(w)>=2 and w[0]=='prefix': vars.base = w[1]
     if len(w)>=2 and w[0]=='mismatches1': vars.mm1 = int(w[1])
     if len(w)>=2 and w[0]=='transposon': vars.transposon = w[1]
+    if len(w)>=2 and w[0]=='protocol': vars.protocol = " ".join(w[1:])
+    if len(w)>=2 and w[0]=='primer': vars.prefix = w[1]
+    if len(w)>=2 and w[0]=='flags': vars.flags = " ".join(w[1:])
+
 
 def save_config(vars):
   f = open("tpp.cfg","w")
@@ -783,10 +965,13 @@ def save_config(vars):
   f.write("prefix %s\n" % vars.base)
   f.write("mismatches1 %s\n" % vars.mm1) 
   f.write("transposon %s\n" % vars.transposon)
+  f.write("protocol %s\n" % vars.protocol)
+  f.write("primer %s\n" % vars.prefix)
+  f.write("flags %s\n" % vars.flags)
   f.close()
 
 def show_help():
-  print 'usage: python PATH/src/tpp.pyc -bwa <PATH_TO_EXECUTABLE> -ref <REF_SEQ> -reads1 <FASTQ_OR_FASTA_FILE> [-reads2 <FASTQ_OR_FASTA_FILE>] -output <BASE_FILENAME> [-maxreads <N>] [-mismatches <N>] [-tn5|-himar1] [-primer <seq>]'
+  print 'usage: python PATH/src/tpp.py -bwa <PATH_TO_EXECUTABLE> -ref <REF_SEQ> -reads1 <FASTQ_OR_FASTA_FILE> [-reads2 <FASTQ_OR_FASTA_FILE>] -output <BASE_FILENAME> [-maxreads <N>] [-mismatches <N>] [-flags "<STRING>"] [-tn5|-himar1] [-primer <seq>]'
     
 class Globals:
   pass

src/pytransit/__init__.py

-__all__ = []
 
-#__all__ = ["transit_tools", "tnseq_tools", "norm_tools", "stat_tools"]
+__all__ = ["transit_tools", "tnseq_tools", "norm_tools", "stat_tools"]
 
-__version__ = "v2.0.2"
+
+__version__ = "v2.1.1"
 prefix = "[TRANSIT]"
+

src/pytransit/__main__.py

@@ -20,7 +20,10 @@ import pytransit.analysis
 
 method_wrap_width = 250
 methods = pytransit.analysis.methods
-
+export_methods = pytransit.analysis.export_methods
+all_methods = {}
+all_methods.update(methods)
+all_methods.update(export_methods)
 
 wildcard = "Python source (*.py)|*.py|" \
             "All files (*.*)|*.*"
@@ -29,20 +32,26 @@ transit_prefix = "[TRANSIT]"
 
 def main(args=None):
     #If no arguments, show GUI:
-    if len(sys.argv) == 1 and hasWx:
-        import pytransit.transit_gui as transit_gui
+    DEBUG = "--debug" in sys.argv
+    if DEBUG:
+        sys.argv.remove("--debug")
 
+    # Check if running in GUI Mode
+    if len(sys.argv) == 1 and hasWx:
 
+        import pytransit.transit_gui as transit_gui
         transit_tools.transit_message("Running in GUI Mode")
 
         app = wx.App(False)
 
         #create an object of CalcFrame
-        frame = transit_gui.TnSeekFrame(None)
+        frame = transit_gui.TnSeekFrame(None, DEBUG)
         #show the frame
         frame.Show(True)
         #start the applications
         app.MainLoop()
+    
+    # Tried GUI mode but has no wxPython
     elif len(sys.argv) == 1 and not hasWx:
         print "Please install wxPython to run in GUI Mode."
         print "To run in Console Mode please follow these instructions:"
@@ -51,16 +60,17 @@ def main(args=None):
         print "List of known methods:"
         for m in methods:
             print "\t - %s" % m
+    # Running in Console mode
     else:
         method_name = sys.argv[1]
-        if method_name not in methods:
+        if method_name not in all_methods:
             print "Error: The '%s' method is unknown." % method_name
             print "Please use one of the known methods (or see documentation to add a new one):"
-            for m in methods:
+            for m in all_methods:
                 print "\t - %s" % m
             print "Usage: python %s <method>" % sys.argv[0]
         else:
-            methodobj = methods[method_name].method.fromconsole()
+            methodobj = all_methods[method_name].method.fromconsole()
             methodobj.Run()
 
 

src/pytransit/analysis/__init__.py

@@ -8,7 +8,7 @@ __all__ = [ basename(f)[:-3] for f in modules if isfile(f)]
 import base
 
 import gumbel
-#import example
+import example
 import tn5gaps
 import binomial
 import griffin
@@ -18,7 +18,7 @@ import rankproduct
 
 
 methods = {}
-#methods["example"] = example.ExampleAnalysis()
+methods["example"] = example.ExampleAnalysis()
 methods["gumbel"] = gumbel.GumbelAnalysis()
 methods["binomial"] = binomial.BinomialAnalysis()
 methods["griffin"] = griffin.GriffinAnalysis()
@@ -26,6 +26,15 @@ methods["hmm"] = hmm.HMMAnalysis()
 methods["resampling"] = resampling.ResamplingAnalysis()
 methods["tn5gaps"] = tn5gaps.Tn5GapsAnalysis()
 methods["rankproduct"] = rankproduct.RankProductAnalysis()
+#methods["mcce"] = mcce.MCCEAnalysis()
+#methods["mcce2"] = mcce2.MCCE2Analysis()
+#methods["motifhmm"] = motifhmm.MotifHMMAnalysis()
+
+
+# EXPORT METHODS
+import norm
+export_methods = {}
+export_methods["norm"] = norm.NormAnalysis()
 
 
 

src/pytransit/analysis/base.py

@@ -22,11 +22,75 @@ import pytransit.transit_tools as transit_tools
 
 file_prefix = "[FileDisplay]"
 
-class TransitFile:
+class InvalidArgumentException(Exception):
+    def __init__(self, message):
+
+        # Call the base class constructor with the parameters it needs
+        super(InvalidArgumentException, self).__init__(message)
+
+if hasWx:
+    class InfoIcon(wx.StaticBitmap):
+        def __init__(self, panel, flag, bmp=None, tooltip=""):
+            if not bmp:
+                bmp = wx.ArtProvider.GetBitmap(wx.ART_INFORMATION, wx.ART_OTHER, (16, 16))
+            wx.StaticBitmap.__init__(self, panel, flag, bmp)
+            tp = wx.ToolTip(tooltip)
+            self.SetToolTip(tp)
+
+
+class TransitGUIBase:
+
+    def __init__(self):
+        self.wxobj = None
+        self.short_name = "TRANSIT"
+        self.long_name = "TRANSIT"
+
+    def status_message(self, text, time=-1):
+        #TODO: write docstring
+        if self.wxobj:
+            if newWx:
+                wx.CallAfter(pub.sendMessage, "status", msg=(self.short_name, text, time))
+            else:
+                wx.CallAfter(pub.sendMessage, "status", (self.short_name, text, time))
+            wx.Yield()
+
+    def console_message(self, text):
+        #TODO: write docstring
+        sys.stdout.write("[%s] %s\n" % (self.short_name, text))
+
+    def console_message_inplace(self, text):
+        #TODO: write docstring
+        sys.stdout.write("[%s] %s   \r" % (self.short_name, text) )
+        sys.stdout.flush()
+
+    def transit_message(self, text):
+        #TODO: write docstring
+        self.console_message(text)
+        self.status_message(text)
+
+    def transit_message_inplace(self, text):
+        #TODO: write docstring
+        self.console_message_inplace(text)
+        self.status_message(text)
+
+
+    def transit_error(self,text):
+        self.transit_message(text)
+        if self.wxobj:
+            transit_tools.ShowError(text)
+
+    def transit_warning(self,text):
+        self.transit_message(text)
+        if self.wxobj:
+            transit_tools.ShowWarning(text)
+
+
+class TransitFile (TransitGUIBase):
     #TODO write docstring
 
     def __init__(self, identifier="#Unknown", colnames=[]):
         #TODO write docstring
+        TransitGUIBase.__init__(self)
         self.identifier = identifier
         self.colnames = colnames
 
@@ -34,11 +98,20 @@ class TransitFile:
         #TODO write docstring
         row = 0
         data = []
+        shownError = False
         for line in open(path):
             if line.startswith("#"): continue
             tmp = line.split("\t")
             tmp[-1] = tmp[-1].strip()
+            #print colnames
+            #print  len(colnames), len(tmp)
+            try:
                 rowdict = dict([(colnames[i], tmp[i]) for i in range(len(colnames))])
+            except Exception as e:
+                if not shownError:
+                    self.transit_warning("Error reading data! This may be caused by trying to load a old results file, when the format has changed.")
+                    shownError = True
+                rowdict = dict([(colnames[i], tmp[i]) for i in range(min(len(colnames), len(tmp)))])
             data.append((row, rowdict))
             row+=1
         return data
@@ -69,6 +142,8 @@ class AnalysisGUI:
     def __init__(self):
         self.wxobj = None
         self.panel = None
+        self.LABELSIZE = (100,-1)
+        self.WIDGETSIZE = (100,-1)
 
     def Hide(self):
         self.panel.Hide()
@@ -107,6 +182,41 @@ class AnalysisGUI:
         Button.Bind( wx.EVT_BUTTON, self.wxobj.RunMethod )
         self.panel = wPanel
 
+    def defineTextBox(self, panel, labelText="", widgetText="", tooltipText="", labSize=None, widgetSize=None):
+        if not labSize: labSize = self.LABELSIZE
+        if not widgetSize: widgetSize = self.WIDGETSIZE
+
+        sizer = wx.BoxSizer( wx.HORIZONTAL )
+        label = wx.StaticText(panel, wx.ID_ANY, labelText, wx.DefaultPosition, labSize, 0)
+        label.Wrap( -1 )
+        textBox = wx.TextCtrl( panel, wx.ID_ANY, widgetText, wx.DefaultPosition, widgetSize, 0 )
+        sizer.Add(label, 0, wx.ALIGN_CENTER_VERTICAL, 5 )
+        sizer.Add(textBox, 0, wx.ALIGN_CENTER_VERTICAL, 5 )
+        sizer.Add(InfoIcon(panel, wx.ID_ANY, tooltip=tooltipText), 0, wx.ALIGN_CENTER_VERTICAL, 5 )
+        return (label, textBox, sizer)
+
+    def defineChoiceBox(self, panel, labelText="", widgetChoice=[""], tooltipText="", labSize=None, widgetSize=None):
+        if not labSize: labSize = self.LABELSIZE
+        if not widgetSize: widgetSize = self.WIDGETSIZE
+
+        sizer = wx.BoxSizer( wx.HORIZONTAL )
+        label = wx.StaticText(panel, wx.ID_ANY, labelText, wx.DefaultPosition, labSize, 0)
+        label.Wrap( -1 )
+        choiceBox = wx.Choice( panel, wx.ID_ANY, wx.DefaultPosition, widgetSize, widgetChoice, 0 )
+        choiceBox.SetSelection(0)
+        sizer.Add(label, 0, wx.ALIGN_CENTER_VERTICAL, 5 )
+        sizer.Add(choiceBox, 0, wx.ALIGN_CENTER_VERTICAL, 5 )
+        sizer.Add(InfoIcon(panel, wx.ID_ANY, tooltip=tooltipText), 0, wx.ALIGN_CENTER_VERTICAL, 5 )
+        return (label, choiceBox, sizer)
+
+    def defineCheckBox(self, panel, labelText="", widgetCheck=False, tooltipText="", widgetSize=None):
+        if not widgetSize: widgetSize = self.WIDGETSIZE
+        sizer = wx.BoxSizer( wx.HORIZONTAL )
+        checkBox = wx.CheckBox(panel, label = labelText, size=widgetSize)
+        checkBox.SetValue(widgetCheck)
+        sizer.Add(checkBox, 0, wx.ALIGN_CENTER_VERTICAL, 5 )
+        sizer.Add(InfoIcon(panel, wx.ID_ANY, tooltip=tooltipText), 0, wx.ALIGN_CENTER_VERTICAL, 5 )
+        return (checkBox, sizer)
 
 
 class AnalysisMethod:
@@ -140,8 +250,11 @@ class AnalysisMethod:
         #TODO: write docstring
         try:
             return self.fromargs(sys.argv[2:])
+        except InvalidArgumentException as e:
+            print "Error: %s" % str(e)
+            print self.usage_string()
         except IndexError as e:
-            traceback.print_exc()
+            print "Error: %s" % str(e)
             print self.usage_string()
         except TypeError as e:
             print "Error: %s" % str(e)
@@ -218,13 +331,13 @@ class AnalysisMethod:
 
         
 
-    def status_message(self, text):
+    def status_message(self, text, time=-1):
         #TODO: write docstring
         if self.wxobj:
             if newWx:
-                wx.CallAfter(pub.sendMessage, "status", msg=(self.short_name, text))
+                wx.CallAfter(pub.sendMessage, "status", msg=(self.short_name, text, time))
             else:
-                wx.CallAfter(pub.sendMessage, "status", (self.short_name, text))
+                wx.CallAfter(pub.sendMessage, "status", (self.short_name, text, time))
             wx.Yield()
 
     def console_message(self, text):
@@ -328,7 +441,7 @@ class TransitAnalysis:
         elif len(self.transposons) == 1:
             return "Intended for %s only" % self.transposons[0]
         elif len(self.transposons) == 2:
-            return "Intended for %s && %s" % tuple(self.transposons)
+            return "Intended for %s or %s" % tuple(self.transposons)
         else:
             return "Intended for " + ", ".join(self.transposons[:-1]) + ", and " + self.transposons[-1]
     

src/pytransit/analysis/binomial.py

@@ -349,6 +349,7 @@ class BinomialMethod(base.SingleConditionMethod):
         kp1c_std = 1.1
 
 
+        numpy.seterr(divide='ignore')
         for i in range(1, sample_size):
 
             i0 = Z[:,i-1] == 0; n0 = numpy.sum(i0);
@@ -405,6 +406,7 @@ class BinomialMethod(base.SingleConditionMethod):
 
             if Kp1_c <= 0: Kp1[i] = Kp1[i-1]
             else:
+                
                 fc = numpy.log(scipy.stats.gamma.pdf(Kp1_c, self.a1, self.b1));
                 f1 = numpy.log(scipy.stats.gamma.pdf(Kp1[i-1], self.a1, self.b1));
                 fc += numpy.sum(numpy.log(scipy.stats.beta.pdf(theta[i1,i], Kp1_c*rho1[i], Kp1_c*(1-rho1[i]))))
@@ -440,10 +442,11 @@ class BinomialMethod(base.SingleConditionMethod):
 
 
             #Update progress
-            text = "Running Gumbel Method... %2.0f%%" % (100.0*(i+1)/(sample_size))
+            text = "Running Binomial Method... %2.0f%%" % (100.0*(i+1)/(sample_size))
             self.progress_update(text, i)
             self.transit_message_inplace(text)
 
+        numpy.seterr(divide='warn')
 
         z_bar = numpy.apply_along_axis(numpy.mean, 1, Z[:, self.burnin:])
         theta_bar = numpy.apply_along_axis(numpy.mean, 1, theta[:, self.burnin:])
@@ -457,7 +460,7 @@ class BinomialMethod(base.SingleConditionMethod):
             memberstr = ""
             for m in members:
                 memberstr += "%s = %s, " % (m, getattr(self, m))
-            self.output.write("#GUI with: ctrldata=%s, annotation=%s, output=%s, samples=%s, burnin=%s\n" % (",".join(self.ctrldata), self.annotation_path, self.output.name, self.samples, self.burnin))
+            self.output.write("#GUI with: ctrldata=%s, annotation=%s, output=%s, samples=%s, burnin=%s\n" % (",".join(self.ctrldata).encode('utf-8'), self.annotation_path.encode('utf-8'), self.output.name.encode('utf-8'), self.samples, self.burnin))
         else:
             self.output.write("#Console: python %s\n" % " ".join(sys.argv))
 

src/pytransit/analysis/example.py

@@ -167,7 +167,7 @@ class ExampleMethod(base.SingleConditionMethod):
         
         #Get orf data
         self.transit_message("Getting Data")
-        G = tnseq_tools.Genes(self.ctrldata, self.annotation_path, ignoreCodon=self.ignoreCodon, nterm=self.NTerminus, cterm=self.CTerminus)
+        G = tnseq_tools.Genes(self.ctrldata, self.annotation_path, norm="TTR", ignoreCodon=self.ignoreCodon, nterm=self.NTerminus, cterm=self.CTerminus)
 
         data = []
         N = len(G)
@@ -175,7 +175,11 @@ class ExampleMethod(base.SingleConditionMethod):
         self.progress_range(N)
         for gene in G:
             count+=1
+            if gene.n == 0:
+                mean = 0.0
+            else:
                 mean = numpy.mean(gene.reads)
+
             if gene.k == 0:
                 nzmean = 0.0
             else:
@@ -194,12 +198,12 @@ class ExampleMethod(base.SingleConditionMethod):
             memberstr = ""
             for m in members:
                 memberstr += "%s = %s, " % (m, getattr(self, m))
-            self.output.write("#GUI with: ctrldata=%s, annotation=%s, output=%s\n" % (",".join(self.ctrldata), self.annotation_path, self.output))
+            self.output.write("#GUI with: ctrldata=%s, annotation=%s, output=%s\n" % (",".join(self.ctrldata).encode('utf-8'), self.annotation_path.encode('utf-8'), self.output.name.encode('utf-8')))
         else:
             self.output.write("#Console: python %s\n" % " ".join(sys.argv))
 
-        self.output.write("#Data: %s\n" % (",".join(self.ctrldata))) 
-        self.output.write("#Annotation path: %s\n" % (",".join(self.ctrldata))) 
+        self.output.write("#Data: %s\n" % (",".join(self.ctrldata).encode('utf-8'))) 
+        self.output.write("#Annotation path: %s\n" % self.annotation_path.encode('utf-8')) 
         self.output.write("#Time: %s\n" % (time.time() - start_time))
         self.output.write("#%s\n" % "\t".join(columns))
 

src/pytransit/analysis/griffin.py

@@ -118,6 +118,7 @@ class GriffinMethod(base.SingleConditionMethod):
                 ctrldata,
                 annotation_path,
                 output_file,
+                minread=1,
                 replicates="Sum",
                 normalization=None,
                 LOESS=False,
@@ -125,7 +126,8 @@ class GriffinMethod(base.SingleConditionMethod):
                 NTerminus=0.0,
                 CTerminus=0.0, wxobj=None):
 
-        base.SingleConditionMethod.__init__(self, short_name, long_name, description, ctrldata, annotation_path, output_file, replicates=replicates, normalization=normalization, LOESS=LOESS, NTerminus=NTerminus, CTerminus=CTerminus, wxobj=wxobj)
+        base.SingleConditionMethod.__init__(self, short_name, long_name, description, ctrldata, annotation_path, output_file, replicates=replicates, normalization=normalization, LOESS=LOESS, ignoreCodon=ignoreCodon, NTerminus=NTerminus, CTerminus=CTerminus, wxobj=wxobj)
+        self.minread = minread
 
 
     @classmethod
@@ -147,6 +149,9 @@ class GriffinMethod(base.SingleConditionMethod):
             return None
 
 
+        #
+        minread = 1
+
         #Read the parameters from the wxPython widgets
         ignoreCodon = True
         NTerminus = float(wxobj.globalNTerminusText.GetValue())
@@ -168,6 +173,7 @@ class GriffinMethod(base.SingleConditionMethod):
         return self(ctrldata,
                 annotationPath,
                 output_file,
+                minread,
                 replicates,
                 normalization,
                 LOESS,
@@ -185,16 +191,19 @@ class GriffinMethod(base.SingleConditionMethod):
         outpath = args[2]
         output_file = open(outpath, "w")
 
-        replicates = "Sum"
+        minread = int(kwargs.get("m", 1))
+        replicates = kwargs.get("r", "Sum")
         normalization = None
         LOESS = False
-        ignoreCodon = True
-        NTerminus = 0.0
-        CTerminus = 0.0
+        ignoreCodon = not kwargs.get("sC", False)
+        NTerminus = float(kwargs.get("iN", 0.0))
+        CTerminus = float(kwargs.get("iC", 0.0))
+
 
         return self(ctrldata,
                 annotationPath,
                 output_file,
+                minread,
                 replicates,
                 normalization,
                 LOESS,
@@ -210,7 +219,7 @@ class GriffinMethod(base.SingleConditionMethod):
 
         #Get orf data
         self.transit_message("Getting Data")
-        G = tnseq_tools.Genes(self.ctrldata, self.annotation_path, ignoreCodon=self.ignoreCodon, nterm=self.NTerminus, cterm=self.CTerminus)
+        G = tnseq_tools.Genes(self.ctrldata, self.annotation_path, minread=self.minread, reps=self.replicates, ignoreCodon=self.ignoreCodon, nterm=self.NTerminus, cterm=self.CTerminus)
 
         N = len(G)
         self.progress_range(N)
@@ -246,12 +255,12 @@ class GriffinMethod(base.SingleConditionMethod):
             memberstr = ""
             for m in members:
                 memberstr += "%s = %s, " % (m, getattr(self, m))
-            self.output.write("#GUI with: ctrldata=%s, annotation=%s, output=%s\n" % (",".join(self.ctrldata), self.annotation_path, self.output.name))
+            self.output.write("#GUI with: ctrldata=%s, annotation=%s, output=%s\n" % (",".join(self.ctrldata).encode('utf-8'), self.annotation_path.encode('utf-8'), self.output.name.encode('utf-8')))
         else:
             self.output.write("#Console: python %s\n" % " ".join(sys.argv))
 
-        self.output.write("#Data: %s\n" % (",".join(self.ctrldata))) 
-        self.output.write("#Annotation path: %s\n" % (",".join(self.ctrldata))) 
+        self.output.write("#Data: %s\n" % (",".join(self.ctrldata).encode('utf-8'))) 
+        self.output.write("#Annotation path: %s\n" % self.annotation_path.encode('utf-8')) 
         self.output.write("#Time: %s\n" % (time.time() - start_time))
         self.output.write("#%s\n" % "\t".join(columns))
         
@@ -268,7 +277,15 @@ class GriffinMethod(base.SingleConditionMethod):
 
     @classmethod
     def usage_string(self):
-        return """python %s griffin <comma-separated .wig files> <annotation .prot_table> <output file>""" % (sys.argv[0])
+        return """python %s griffin <comma-separated .wig files> <annotation .prot_table> <output file> [Optional Arguments]
+
+        Optional Arguments:
+        -m <integer>    :=  Smallest read-count to consider. Default: -m 1
+        -r <string>     :=  How to handle replicates. Sum or Mean. Default: -r Sum
+        -sC             :=  Include stop-codon (default is to ignore).
+        -iN <float>     :=  Ignore TAs occuring at given fraction of the N terminus. Default: -iN 0.0
+        -iC <float>     :=  Ignore TAs occuring at given fraction of the C terminus. Default: -iC 0.0
+        """ % (sys.argv[0])
 
 
 if __name__ == "__main__":