Skip to content

Commits on Source 6

# TRANSIT 2.1.0
# TRANSIT 2.1.2
[![Build Status](https://travis-ci.org/mad-lab/transit.svg?branch=master)](https://travis-ci.org/mad-lab/transit) [![Documentation Status](https://readthedocs.org/projects/transit/badge/?version=latest)](http://transit.readthedocs.io/en/latest/?badge=latest)
**Version 2.1.0 changes (June, 20017)**
**Version 2.1.2 changes (May, 2018)**
- Improved resampling on comparisons with unbalanced number of replicates.
- Improved speed of TPP.
- Added Barseq functionality to TPP.
- Fixed bug with creating resampling histograms on GUI mode.
- Miscellaneous code improvements.
**Version 2.1.1 changes (July, 2017)**
- Miscellaneous bug fixes
**Version 2.1.0 changes (June, 2017)**
- Added tooltips next to most parameters to explain their functionality.
- Added Quality Control window, with choice for normalization method.
- Added more normalization options to the HMM method.
......@@ -23,7 +36,6 @@
- Lots of bug fixes.
**Version 2.0.2 changes (August, 2016)**
- Added support for for custom primers in TPP.
- Added support for annotations in GFF3 format.
......
version: 2.1.0-18-g4192-mod
version: 2.1.2-1-gccf8-mod
tnseq-transit (2.1.2-1) unstable; urgency=medium
* New upstream version
* Point Vcs fields to salsa.debian.org
* Standards-Version: 4.1.4
-- Andreas Tille <tille@debian.org> Tue, 22 May 2018 16:41:34 +0200
tnseq-transit (2.1.1-1) unstable; urgency=medium
* New upstream version
......
......@@ -6,9 +6,9 @@ Priority: optional
Build-Depends: debhelper (>= 11~),
python-all-dev,
python-setuptools
Standards-Version: 4.1.3
Vcs-Browser: https://anonscm.debian.org/cgit/debian-med/tnseq-transit.git
Vcs-Git: https://anonscm.debian.org/git/debian-med/tnseq-transit.git
Standards-Version: 4.1.4
Vcs-Browser: https://salsa.debian.org/med-team/tnseq-transit
Vcs-Git: https://salsa.debian.org/med-team/tnseq-transit.git
Homepage: http://pythonhosted.org/tnseq-transit/transit_overview.html
Package: tnseq-transit
......
......@@ -38,7 +38,7 @@ def main(arguments=[]):
vars = Globals()
if len(arguments) <= 1 and hasWx:
if len(arguments)==0 and hasWx:
app = wx.App(False)
form = MyForm(vars)
form.update_dataset_list()
......@@ -78,7 +78,8 @@ def main(arguments=[]):
# Check for strange flags
known_flags = set(["tn5", "help", "himar1", "protocol", "primer", "reads1",
"reads2", "bwa", "ref", "maxreads", "output", "mismatches", "flags"])
"reads2", "bwa", "ref", "maxreads", "output", "mismatches", "flags",
"barseq_catalog_in", "barseq_catalog_out"])
unknown_flags = set(kwargs.keys()) - known_flags
if unknown_flags:
print "error: unrecognized flags:", ", ".join(unknown_flags)
......
......@@ -95,19 +95,6 @@ if hasWx:
bmp = wx.ArtProvider.GetBitmap(wx.ART_INFORMATION, wx.ART_OTHER, (16, 16))
# BWA
sizer0 = wx.BoxSizer(wx.HORIZONTAL)
label0 = wx.StaticText(panel, label='BWA executable:',size=(330,-1))
sizer0.Add(label0,0,wx.ALIGN_CENTER_VERTICAL,0)
self.picker0 = wx.lib.filebrowsebutton.FileBrowseButton(panel, id = wx.ID_ANY, size=(400,30), dialogTitle='Path to BWA', fileMode=wx.OPEN, fileMask='bwa*', startDirectory=os.path.dirname(vars.bwa), initialValue=vars.bwa, labelText='')
sizer0.Add(self.picker0, proportion=1, flag=wx.EXPAND|wx.ALL, border=5)
sizer0.Add(TPPIcon(panel, wx.ID_ANY, bmp, "Specify a path to the BWA executable (including the executable)."), flag=wx.CENTER, border=0)
sizer0.Add((10, 1), 0, wx.EXPAND)
sizer.Add(sizer0,0,wx.EXPAND,0)
# REFERENCE
sizer3 = wx.BoxSizer(wx.HORIZONTAL)
label3 = wx.StaticText(panel, label='Choose a reference genome (FASTA):',size=(330,-1))
......@@ -147,7 +134,7 @@ if hasWx:
self.base = wx.TextCtrl(panel,value=vars.base,size=(400,30))
sizer5.Add(self.base, proportion=1.0, flag=wx.EXPAND|wx.ALL, border=5)
sizer5.Add(TPPIcon(panel, wx.ID_ANY, bmp, "Select a a label prefix that will be used when writing output files e.g. 'wt_run1'"), flag=wx.CENTER, border=0)
sizer5.Add((130, 1), 0, wx.EXPAND)
sizer5.Add((10, 1), 0, wx.EXPAND)
sizer.Add(sizer5,0,wx.EXPAND,0)
......@@ -164,7 +151,7 @@ The Sassetti protocol generally assumes the reads include the primer prefix and
The Mme1 protocol generally assumes reads do NOT include the primer prefix, and that the reads are sequenced in the reverse direction"""
sizer_protocol.Add(TPPIcon(panel, wx.ID_ANY, bmp, protocol_tooltip_text), flag=wx.CENTER, border=0)
sizer_protocol.Add((130, 1), 0, wx.EXPAND)
sizer_protocol.Add((10, 1), 0, wx.EXPAND)
sizer.Add(sizer_protocol,0,wx.EXPAND,0)
self.Bind(wx.EVT_COMBOBOX, self.OnProtocolSelection, id=self.protocol.GetId())
......@@ -178,7 +165,7 @@ The Mme1 protocol generally assumes reads do NOT include the primer prefix, and
self.transposon.SetStringSelection(vars.transposon)
sizer8.Add(self.transposon, proportion=1, flag=wx.EXPAND|wx.ALL, border=5)
sizer8.Add(TPPIcon(panel, wx.ID_ANY, bmp, "Select the transposon used to construct the TnSeq libraries. This will automatically populate the primer prefix field. Select custom to specify your own sequence."), flag=wx.CENTER, border=0)
sizer8.Add((130, 1), 0, wx.EXPAND)
sizer8.Add((10, 1), 0, wx.EXPAND)
sizer.Add(sizer8,0,wx.EXPAND,0)
......@@ -189,7 +176,7 @@ The Mme1 protocol generally assumes reads do NOT include the primer prefix, and
self.prefix = wx.TextCtrl(panel,value=str(vars.prefix), size=(400,30))
sizer4.Add(self.prefix, proportion=1, flag=wx.EXPAND|wx.ALL, border=5)
sizer4.Add(TPPIcon(panel, wx.ID_ANY, bmp, "If present in the reads, specify the primer sequence. If it has been stripped away already, leave this field empty."), flag=wx.CENTER, border=0)
sizer4.Add((130, 1), 0, wx.EXPAND)
sizer4.Add((10, 1), 0, wx.EXPAND)
sizer.Add(sizer4,0,wx.EXPAND,0)
self.Bind(wx.EVT_COMBOBOX, self.OnTransposonSelection, id=self.transposon.GetId())
......@@ -199,22 +186,35 @@ The Mme1 protocol generally assumes reads do NOT include the primer prefix, and
sizer6 = wx.BoxSizer(wx.HORIZONTAL)
label6 = wx.StaticText(panel, label='Max reads (leave blank to use all):',size=(340,-1))
sizer6.Add(label6,0,wx.ALIGN_CENTER_VERTICAL,0)
self.maxreads = wx.TextCtrl(panel,size=(400,30))
self.maxreads = wx.TextCtrl(panel,size=(150,30))
sizer6.Add(self.maxreads, proportion=1, flag=wx.EXPAND|wx.ALL, border=5)
sizer6.Add(TPPIcon(panel, wx.ID_ANY, bmp, "Maximum reads to use from the reads files. Useful for running only a portion of very large number of reads. Leave blank to use all the reads."), flag=wx.CENTER, border=0)
sizer6.Add((130, 1), 0, wx.EXPAND)
sizer6.Add((10, 1), 0, wx.EXPAND)
sizer.Add(sizer6,0,wx.EXPAND,0)
# MISMATCHES
sizer7 = wx.BoxSizer(wx.HORIZONTAL)
label7 = wx.StaticText(panel, label='Mismatches allowed in Tn prefix:',size=(340,-1))
sizer7.Add(label7,0,wx.ALIGN_CENTER_VERTICAL,0)
self.mismatches = wx.TextCtrl(panel,value=str(vars.mm1),size=(400,30))
self.mismatches = wx.TextCtrl(panel,value=str(vars.mm1),size=(150,30))
sizer7.Add(self.mismatches, proportion=1, flag=wx.EXPAND|wx.ALL, border=5)
sizer7.Add(TPPIcon(panel, wx.ID_ANY, bmp, "Number of mismatches allowed in the tn-prefix before discarding the read."), flag=wx.CENTER, border=0)
sizer7.Add((130, 1), 0, wx.EXPAND)
sizer7.Add((10, 1), 0, wx.EXPAND)
sizer.Add(sizer7,0,wx.EXPAND,0)
# BWA
sizer0 = wx.BoxSizer(wx.HORIZONTAL)
label0 = wx.StaticText(panel, label='BWA executable:',size=(330,-1))
sizer0.Add(label0,0,wx.ALIGN_CENTER_VERTICAL,0)
self.picker0 = wx.lib.filebrowsebutton.FileBrowseButton(panel, id = wx.ID_ANY, size=(400,30), dialogTitle='Path to BWA', fileMode=wx.OPEN, fileMask='bwa*', startDirectory=os.path.dirname(vars.bwa), initialValue=vars.bwa, labelText='')
sizer0.Add(self.picker0, proportion=1, flag=wx.EXPAND|wx.ALL, border=5)
sizer0.Add(TPPIcon(panel, wx.ID_ANY, bmp, "Specify a path to the BWA executable (including the executable)."), flag=wx.CENTER, border=0)
sizer0.Add((10, 1), 0, wx.EXPAND)
sizer.Add(sizer0,0,wx.EXPAND,0)
# BWA FLAGS
sizer8 = wx.BoxSizer(wx.HORIZONTAL)
label8 = wx.StaticText(panel, label='BWA flags (Optional)',size=(340,-1))
......@@ -222,10 +222,34 @@ The Mme1 protocol generally assumes reads do NOT include the primer prefix, and
self.flags = wx.TextCtrl(panel,value=vars.flags,size=(400,30))
sizer8.Add(self.flags, proportion=1, flag=wx.EXPAND|wx.ALL, border=5)
sizer8.Add(TPPIcon(panel, wx.ID_ANY, bmp, "Use this textobx to enter any desired flags for the BWA alignment. For example, to limit the number of mismatches to 1, type: -k 1. See the BWA documentation for all possible flags."), flag=wx.CENTER, border=0)
sizer8.Add((130, 1), 0, wx.EXPAND)
sizer8.Add((10, 1), 0, wx.EXPAND)
sizer.Add(sizer8,0,wx.EXPAND,0)
# BARSEQ CATALOG
sizer9 = wx.BoxSizer(wx.HORIZONTAL)
label9 = wx.StaticText(panel, label='BarSeq Catalog file:',size=(120,-1))
sizer9.Add(label9,0,wx.ALIGN_CENTER_VERTICAL,0)
self.barseq_select = wx.ComboBox(panel,choices=['this is not a Barseq dataset','read catalog file','write catalog file'],size=(200,30)) ## # does a BoxSizer use wx.HORIZONTAL, not wx.EXPAND?
self.barseq_select.SetSelection(0)
sizer9.Add(self.barseq_select, proportion=0.5, flag=wx.EXPAND|wx.ALL, border=5) ##
self.picker9 = wx.lib.filebrowsebutton.FileBrowseButton(panel, id=wx.ID_ANY, dialogTitle='Please select the Barseq catalog filename', fileMode=wx.OPEN, size=(400,30), startDirectory=os.path.dirname(vars.fq2), initialValue="", labelText='', ) # no need for this: changeCallback=self.OnChanged9 ; initialValue set below ; no file mask
sizer9.Add(self.picker9, proportion=1, flag=wx.EXPAND|wx.ALL, border=5)
if vars.barseq_catalog_in!=None:
self.barseq_select.SetSelection(1)
self.picker9.SetValue(vars.barseq_catalog_in)
if vars.barseq_catalog_out!=None:
self.barseq_select.SetSelection(2)
self.picker9.SetValue(vars.barseq_catalog_out)
sizer9.Add(TPPIcon(panel, wx.ID_ANY, bmp, "Select a filename for BarSeq catalog."), flag=wx.CENTER, border=0)
sizer9.Add((10, 1), 0, wx.EXPAND)
sizer.Add(sizer9,0,wx.EXPAND,0)
#
......@@ -384,6 +408,7 @@ The Mme1 protocol generally assumes reads do NOT include the primer prefix, and
#
def map_reads(self,event):
# add bwa path, prefix
bwapath = self.picker0.GetValue()
fq1, fq2, ref, base, prefix, maxreads = self.picker1.GetValue(), self.picker2.GetValue(), self.picker3.GetValue(), self.base.GetValue(), self.prefix.GetValue(), self.maxreads.GetValue()
......@@ -408,6 +433,11 @@ The Mme1 protocol generally assumes reads do NOT include the primer prefix, and
if maxreads == '': self.vars.maxreads = -1
else: self.vars.maxreads = int(maxreads)
barseq_select = self.barseq_select.GetSelection()
self.vars.barseq_catalog_in = self.vars.barseq_catalog_out = None
if barseq_select==1: self.vars.barseq_catalog_in = self.picker9.GetValue()
if barseq_select==2: self.vars.barseq_catalog_out = self.picker9.GetValue()
self.vars.action = "start"
self.Close()
return 0
......
......@@ -25,6 +25,7 @@ import sys, re, shutil
import platform
import gzip
import subprocess
from collections import defaultdict
def cleanargs(rawargs):
#TODO: Write docstring
......@@ -143,6 +144,72 @@ def fix_paired_headers_for_bwa(reads1,reads2):
os.system("mv %s %s" % (temp2, reads2))
'''
# checks for a match allowing 1 or 2 mismatches
# if not a match returns -1,-1. If match occurs, returns 1 and the start index of match
def bit_parallel_with_max_2_error(text, pattern, m):
S_table = defaultdict(int)
for i, c in enumerate(pattern):
S_table[c] |= 1 << i
R0 = 0
R1 = 0
R2 = 0
mask = 1 << (m - 1)
for j, c in enumerate(text):
S = S_table[c]
shR0 = (R0 << 1) | 1
shR1 = (R1 << 1) | 1
R0 = shR0 & S
R1 = ((R1 << 1) | 1) & S | shR0
R2 = ((R2 << 1) | 1) & S | shR1
# first if-statement commented because we have already checked for exact match using find() in mmfind()
#if R0 & mask: #exact match
#return 1, j - m + 1
if R1 & mask: # 1 mismatch
return 1, j - m + 1
if R2 & mask: # 2 mismatches
return 1, j - m + 1
return -1,-1
# checks for a match allowing 1 mismatch
# if not a match returns -1,-1. If match occurs, returns 1 and the start index of match
def bit_parallel_with_max_1_error(text, pattern, m):
S_table = defaultdict(int)
for i, c in enumerate(pattern):
S_table[c] |= 1 << i
R0 = 0
R1 = 0
mask = 1 << (m - 1)
for j, c in enumerate(text):
S = S_table[c]
shR0 = (R0 << 1) | 1
R0 = shR0 & S
R1 = ((R1 << 1) | 1) & S | shR0
# first if-statement commented because we have already checked for exact match using find() in mmfind()
#if R0 & mask: #exact match
#return 1, j - m + 1
if R1 & mask: # 1 mismatch
return 1, j - m + 1
return -1,-1
# this function is a replacement for below mmfind() for speedup
# it assumes the length of H is <32
# find index of H[1..m] in G[1..n] with up to max (1 or 2) mismatches
def mmfind(G,n,H,m,max): # lengths; assume n>m
a = G.find(H)
if a!=-1: return a # shortcut for perfect matches
a,b = -1,-1
if max==1 :
a,b = bit_parallel_with_max_1_error(G, H, m)
elif max==2 :
a,b = bit_parallel_with_max_2_error(G, H, m)
if a==1: return b
return -1
''' replaced with above mmfind()
# find index of H[1..m] in G[1..n] with up to max mismatches
def mmfind(G,n,H,m,max): # lengths; assume n>m
......@@ -155,6 +222,8 @@ def mmfind(G,n,H,m,max): # lengths; assume n>m
if cnt>max: break
if cnt<=max: return i
return -1
'''
def extract_staggered(infile,outfile,vars):
Tn = vars.prefix
......@@ -165,12 +234,19 @@ def extract_staggered(infile,outfile,vars):
#P,Q = 5,10 # 1-based inclusive positions to look for start of Tn prefix
P,Q = 0,15
if vars.barseq_catalog_out!=None: Q = 100 # relax for barseq
vars.tot_tgtta = 0
vars.truncated_reads = 0
output = open(outfile,"w")
tot = 0
#print infile
if vars.barseq_catalog_out!=None:
barcodes_file = vars.base+".barseq" # I could define this in vars
catalog = open(barcodes_file,"w")
barseq1 = "TGCAGGGATGTCCACGAGGTCTCT" # const regions surrounding barcode
barseq2 = "CGTACGCTGCAGGTCGACGGCCGG"
barseq1len,barseq2len = len(barseq1),len(barseq2)
for line in open(infile):
#print line
line = line.rstrip()
......@@ -184,21 +260,30 @@ def extract_staggered(infile,outfile,vars):
if a>=P and a<=Q:
gstart,gend = a+lenTn,readlen
if b!=-1: gend = b; vars.truncated_reads += 1
#if gend-gstart<20: continue # too short
if gend-gstart<5: continue # too short
if gend-gstart<20: continue # too short # I should make this a param
output.write(header+"\n")
output.write(line[gstart:gend]+"\n")
vars.tot_tgtta += 1
if vars.barseq_catalog_out!=None:
n = max(a,readlen)
c = mmfind(line,n,barseq1,barseq1len,vars.mm1) # only have to search as far as Tn prefix
d = mmfind(line,n,barseq2,barseq2len,vars.mm1)
seq = "XXXXXXXXXXXXXXXXXXXX"
if c!=-1 and d!=-1:
size = d-c-barseq1len
if size>=15 and size<=25: seq = line[c+barseq1len:d]
catalog.write(header+"\n")
catalog.write(seq+"\n")
if vars.barseq_catalog_out!=None: catalog.close()
output.close()
if vars.tot_tgtta == 0:
raise ValueError("Error: Input files did not contain any reads matching prefix sequence with %d mismatches" % vars.mm1)
def message(s):
print "[tn_preprocess]",s
sys.stdout.flush()
#print "[tn_preprocess]",s
#sys.stdout.flush()
sys.stderr.write("[tn_preprocess] "+s+"\n")
def get_id(line):
a,b = line.find(":")+1,line.rfind("#")
......@@ -683,7 +768,89 @@ def get_genomic_portion(filename):
return tot_len/n
# return list of (item,cnt) sorted by counts
def popularity(lst):
hash = {}
for x in lst:
if x not in hash: hash[x] = 0
hash[x] += 1
data = [(hash[x],x) for x in hash.keys()]
data.sort(reverse=True)
data = [(y,x) for (x,y) in data]
return data
def create_barseq_catalog(vars):
barcodes = {} # headers->barcodes
for line in open(vars.base+".barseq"):
if line[0]=='>':
header = line.rstrip()[1:]
header = header.split()[0] # in case it has a space, which is dropped by bwa in sam file
else: barcodes[header] = line.split('\n')[0]
sites,nreads = {},0
for line in open(vars.sam):
if line[0]=='@': continue
w = line.split('\t')
samcode = int(w[1])
nreads += 1
if samcode in [0,16]: # what about PE reads?
header,coord = w[0],int(w[3])
# see how I adjust coords in read_counts()
strand,delta = 'F',-2
if samcode==16: strand,delta = 'R',len(w[9]);
coord += delta
if strand=='R': coord *= -1
if coord not in sites: sites[coord] = [] # use -co for minus strand
sites[coord].append(barcodes[header])
mapsto = {} # barcodes->sites
totbc,maptoTAs = 0,0
genome = read_genome(vars.ref)
for site,bclist in sites.items():
for bc in bclist:
if bc not in mapsto: mapsto[bc] = []
if 'X' not in bc:
mapsto[bc].append(site)
totbc += 1
if site<0: site *= -1
if genome[site-1:site+1]=="TA": maptoTAs += 1
# good barcodes are those that are associated with only 1 site (must be TA?)
# what about redundant sites like IS elements?
goodbc = {}
for bc,sites2 in mapsto.items():
pop = popularity(sites2) # make a table of locations at which the barcode appears
#print bc,pop
if len(pop)==1: goodbc[bc] = 1
#for x in sorted(sites.items()): print x[0],genome[x[0]-1:x[0]+1],popularity(x[1])
file = open(vars.barseq_catalog_out,"w")
file.write("# Barseq (stats are at the bottom): reads = %s, ref = %s\n" % (vars.fq1,vars.ref))
n = len(genome)
a,b = 0,0
for i in range(n-1):
if genome[i:i+2]=="TA":
a += 1
co = i+1
barcodes_pos = [(x,'+') for x in sites.get(co,[])]
barcodes_neg = [(x,'-') for x in sites.get(-co,[])]
pop = popularity(barcodes_pos+barcodes_neg)
if len(pop)>0: b += 1
else: file.write("# %s %s\n" %(co,genome[i:i+2]))
for (bc,strand),cnt in pop:
if bc in goodbc:
file.write("%s %s %s %s %s\n" % (co,genome[i:i+2],strand,bc,cnt))
file.write("# total_reads: %s, total_barcodes: %s, map_to_TAs: %s, distinct_bc: %s, unimapped: %s, TA_sites_hit: %s/%s\n" % (nreads,totbc,maptoTAs,len(mapsto.keys()),len(goodbc.keys()),b,a))
file.close()
def generate_output(vars):
if vars.barseq_catalog_out!=None:
message("creating Barseq catalog file: "+vars.barseq_catalog_out)
create_barseq_catalog(vars)
message("tabulating template counts and statistics...")
if vars.single_end==True: counts = read_counts(vars.ref,vars.sam,vars) # return read counts copied as template counts
else: counts = template_counts(vars.ref,vars.sam,vars.barcodes1,vars)
......@@ -874,6 +1041,7 @@ def verify_inputs(vars):
if not os.path.exists(vars.ref): error("reference file not found: "+vars.ref)
if vars.base == '': error("prefix cannot be empty")
if vars.fq1 == vars.fq2: error('fastq files cannot be identical')
if vars.barseq_catalog_in!=None and vars.barseq_catalog_out!=None: error('barseq catalog input and output files cannot both be defined at the same time')
# If Mme1 protocol, warn that we don't use read2 file
if vars.protocol.lower() == "mme1" and not vars.single_end:
......@@ -902,6 +1070,7 @@ def initialize_globals(vars, args=[], kwargs={}):
vars.protocol = "Sassetti"
vars.prefix = "ACTTATCAGCCAACCTGTTA"
vars.flags = ""
vars.barseq_catalog_in = vars.barseq_catalog_out = None
# Update defaults
protocol = kwargs.get("protocol", "").lower()
......@@ -935,9 +1104,13 @@ def initialize_globals(vars, args=[], kwargs={}):
vars.base = kwargs["output"]
if "mismatches" in kwargs:
vars.mm1 = int(kwargs["mismatches"])
if "barseq_catalog_in" in kwargs:
vars.barseq_catalog_in = kwargs["barseq_catalog_in"]
if "barseq_catalog_out" in kwargs:
vars.barseq_catalog_out = kwargs["barseq_catalog_out"]
if "flags" in kwargs:
vars.flags = kwargs["flags"]
# note: if last flag expected an arg but was end of list, it gets value True ; check for this and report as missing # TRU, 10/28/17
def read_config(vars):
......@@ -954,6 +1127,8 @@ def read_config(vars):
if len(w)>=2 and w[0]=='protocol': vars.protocol = " ".join(w[1:])
if len(w)>=2 and w[0]=='primer': vars.prefix = w[1]
if len(w)>=2 and w[0]=='flags': vars.flags = " ".join(w[1:])
if len(w)>=2 and w[0]=='barseq_catalog_in': vars.barseq_catalog_in = w[1]
if len(w)>=2 and w[0]=='barseq_catalog_out': vars.barseq_catalog_out = w[1]
def save_config(vars):
......@@ -968,12 +1143,12 @@ def save_config(vars):
f.write("protocol %s\n" % vars.protocol)
f.write("primer %s\n" % vars.prefix)
f.write("flags %s\n" % vars.flags)
if vars.barseq_catalog_in!=None: f.write("barseq_catalog_in %s\n" % vars.barseq_catalog_in)
if vars.barseq_catalog_out!=None: f.write("barseq_catalog_out %s\n" % vars.barseq_catalog_out)
f.close()
def show_help():
print 'usage: python PATH/src/tpp.py -bwa <PATH_TO_EXECUTABLE> -ref <REF_SEQ> -reads1 <FASTQ_OR_FASTA_FILE> [-reads2 <FASTQ_OR_FASTA_FILE>] -output <BASE_FILENAME> [-maxreads <N>] [-mismatches <N>] [-flags "<STRING>"] [-tn5|-himar1] [-primer <seq>]'
print 'usage: python PATH/src/tpp.py -bwa <EXECUTABLE_WITH_PATH> -ref <REF_SEQ> -reads1 <FASTQ_OR_FASTA_FILE> [-reads2 <FASTQ_OR_FASTA_FILE>] -output <BASE_FILENAME> [-maxreads <N>] [-mismatches <N>] [-flags "<STRING>"] [-tn5|-himar1] [-primer <seq>] [-barseq_catalog_in|_out <file>]'
class Globals:
pass
......@@ -2,6 +2,6 @@
__all__ = ["transit_tools", "tnseq_tools", "norm_tools", "stat_tools"]
__version__ = "v2.1.1"
__version__ = "v2.1.2"
prefix = "[TRANSIT]"
......@@ -39,9 +39,9 @@ def main(args=None):
# Check if running in GUI Mode
if len(sys.argv) == 1 and hasWx:
import matplotlib.pyplot
import pytransit.transit_gui as transit_gui
transit_tools.transit_message("Running in GUI Mode")
app = wx.App(False)
#create an object of CalcFrame
......@@ -62,6 +62,8 @@ def main(args=None):
print "\t - %s" % m
# Running in Console mode
else:
import matplotlib
matplotlib.use("Agg")
method_name = sys.argv[1]
if method_name not in all_methods:
print "Error: The '%s' method is unknown." % method_name
......@@ -70,6 +72,7 @@ def main(args=None):
print "\t - %s" % m
print "Usage: python %s <method>" % sys.argv[0]
else:
methodobj = all_methods[method_name].method.fromconsole()
methodobj.Run()
......
......@@ -193,7 +193,7 @@ class BinomialMethod(base.SingleConditionMethod):
return None
#Validate transposon types
if not transit_tools.validate_filetypes(ctrldata, transposons):
if not transit_tools.validate_transposons_used(ctrldata, transposons):
return None
......@@ -295,8 +295,19 @@ class BinomialMethod(base.SingleConditionMethod):
self.progress_range(self.samples+self.burnin)
#Get orf data
#self.transit_message("Getting Data")
#G = tnseq_tools.Genes(self.ctrldata, self.annotation_path, ignoreCodon=self.ignoreCodon, nterm=self.NTerminus, cterm=self.CTerminus)
self.transit_message("Getting Data")
G = tnseq_tools.Genes(self.ctrldata, self.annotation_path, ignoreCodon=self.ignoreCodon, nterm=self.NTerminus, cterm=self.CTerminus)
(data, position) = transit_tools.get_validated_data(self.ctrldata, wxobj=self.wxobj)
(K,N) = data.shape
if self.normalization and self.normalization != "nonorm":
self.transit_message("Normalizing using: %s" % self.normalization)
(data, factors) = norm_tools.normalize_data(data, self.normalization, self.ctrldata, self.annotation_path)
G = tnseq_tools.Genes(self.ctrldata, self.annotation_path, minread=1, reps=self.replicates, ignoreCodon=self.ignoreCodon, nterm=self.NTerminus, cterm=self.CTerminus, data=data, position=position)
#Parameters
......
......@@ -101,7 +101,7 @@ class ExampleMethod(base.SingleConditionMethod):
return None
#Validate transposon types
if not transit_tools.validate_filetypes(ctrldata, transposons):
if not transit_tools.validate_transposons_used(ctrldata, transposons):
return None
#Read the parameters from the wxPython widgets
......@@ -135,9 +135,6 @@ class ExampleMethod(base.SingleConditionMethod):
def fromargs(self, rawargs):
(args, kwargs) = transit_tools.cleanargs(rawargs)
print "ARGS:", args
print "KWARGS:", kwargs
ctrldata = args[0].split(",")
annotationPath = args[1]
outpath = args[2]
......@@ -167,7 +164,16 @@ class ExampleMethod(base.SingleConditionMethod):
#Get orf data
self.transit_message("Getting Data")
G = tnseq_tools.Genes(self.ctrldata, self.annotation_path, norm="TTR", ignoreCodon=self.ignoreCodon, nterm=self.NTerminus, cterm=self.CTerminus)
(data, position) = transit_tools.get_validated_data(self.ctrldata, wxobj=self.wxobj)
(K,N) = data.shape
if self.normalization and self.normalization != "nonorm":
self.transit_message("Normalizing using: %s" % self.normalization)
(data, factors) = norm_tools.normalize_data(data, self.normalization, self.ctrldata, self.annotation_path)
G = tnseq_tools.Genes(self.ctrldata, self.annotation_path, minread=1, reps=self.replicates, ignoreCodon=self.ignoreCodon, nterm=self.NTerminus, cterm=self.CTerminus, data=data, position=position)
data = []
N = len(G)
......
......@@ -145,7 +145,7 @@ class GriffinMethod(base.SingleConditionMethod):
return None
#Validate transposon types
if not transit_tools.validate_filetypes(ctrldata, transposons):
if not transit_tools.validate_transposons_used(ctrldata, transposons):
return None
......@@ -219,7 +219,19 @@ class GriffinMethod(base.SingleConditionMethod):
#Get orf data
self.transit_message("Getting Data")
G = tnseq_tools.Genes(self.ctrldata, self.annotation_path, minread=self.minread, reps=self.replicates, ignoreCodon=self.ignoreCodon, nterm=self.NTerminus, cterm=self.CTerminus)
(data, position) = transit_tools.get_validated_data(self.ctrldata, wxobj=self.wxobj)
(K,N) = data.shape
if self.normalization and self.normalization != "nonorm":
self.transit_message("Normalizing using: %s" % self.normalization)
(data, factors) = norm_tools.normalize_data(data, self.normalization, self.ctrldata, self.annotation_path)
G = tnseq_tools.Genes(self.ctrldata, self.annotation_path, minread=1, reps=self.replicates, ignoreCodon=self.ignoreCodon, nterm=self.NTerminus, cterm=self.CTerminus, data=data, position=position)
N = len(G)
self.progress_range(N)
......
......@@ -188,7 +188,7 @@ class GumbelMethod(base.SingleConditionMethod):
return None
#Validate transposon types
if not transit_tools.validate_filetypes(ctrldata, transposons):
if not transit_tools.validate_transposons_used(ctrldata, transposons):
return None
......@@ -321,11 +321,21 @@ class GumbelMethod(base.SingleConditionMethod):
#Get orf data
self.transit_message("Reading Annotation")
self.transit_message("Getting Data")
#Validate data has empty sites
#(status, genome) = transit_tools.validate_wig_format(self.ctrldata, wxobj=self.wxobj)
#if status <2: tn_used = "himar1"
#else: tn_used = "tn5"
self.transit_message("Getting Data")
(data, position) = transit_tools.get_validated_data(self.ctrldata, wxobj=self.wxobj)
(K,N) = data.shape
if self.normalization and self.normalization != "nonorm":
self.transit_message("Normalizing using: %s" % self.normalization)
(data, factors) = norm_tools.normalize_data(data, self.normalization, self.ctrldata, self.annotation_path)
G = tnseq_tools.Genes(self.ctrldata, self.annotation_path, minread=self.minread, reps=self.replicates, ignoreCodon=self.ignoreCodon, nterm=self.NTerminus, cterm=self.CTerminus)
G = tnseq_tools.Genes(self.ctrldata, self.annotation_path, minread=self.minread, reps=self.replicates, ignoreCodon=self.ignoreCodon, nterm=self.NTerminus, cterm=self.CTerminus, data=data, position=position)
ii_good = numpy.array([self.good_orf(g) for g in G]) # Gets index of the genes that can be analyzed
......@@ -359,6 +369,7 @@ class GumbelMethod(base.SingleConditionMethod):
i = 1; count = 0;
while i < self.samples:
try:
# PHI
acc = 1.0
phi_new = phi_old + random.gauss(mu_c, sigma_c)
......@@ -382,6 +393,13 @@ class GumbelMethod(base.SingleConditionMethod):
phi_sample[i] = phi_new
Z_sample[:,i] = Z
i+=1
except ValueError as e:
self.transit_message("Error: %s" % e)
self.transit_message("This is likely to have been caused by poor data (e.g. too sparse).")
self.transit_message("If the density of the dataset is too low, the Gumbel method will not work.")
self.transit_message("Quitting.")
return
phi_old = phi_new
#Update progress
......
......@@ -212,7 +212,7 @@ class HMMMethod(base.SingleConditionMethod):
return None
#Validate transposon types
if not transit_tools.validate_filetypes(ctrldata, transposons):
if not transit_tools.validate_transposons_used(ctrldata, transposons):
return None
......@@ -279,7 +279,7 @@ class HMMMethod(base.SingleConditionMethod):
#Get data
self.transit_message("Getting Data")
(data, position) = tnseq_tools.get_data(self.ctrldata)
(data, position) = transit_tools.get_validated_data(self.ctrldata, wxobj=self.wxobj)
(K,N) = data.shape
# Normalize data
......
......@@ -153,7 +153,7 @@ class RankProductMethod(base.DualConditionMethod):
return None
#Validate transposon types
if not transit_tools.validate_filetypes(ctrldata+expdata, transposons):
if not transit_tools.validate_transposons_used(ctrldata+expdata, transposons):
return None
......@@ -243,7 +243,7 @@ class RankProductMethod(base.DualConditionMethod):
Kexp = len(self.expdata)
#Get orf data
self.transit_message("Getting Data")
(data, position) = tnseq_tools.get_data(self.ctrldata+self.expdata)
(data, position) = transit_tools.get_validated_data(self.ctrldata+self.expdata, wxobj=self.wxobj)
if self.normalization != "none":
self.transit_message("Normalizing using: %s" % self.normalization)
......
......@@ -15,6 +15,7 @@ except Exception as e:
hasWx = False
newWx = False
import os
import time
import ntpath
......@@ -23,7 +24,6 @@ import random
import numpy
import scipy.stats
import datetime
import matplotlib
import base
import pytransit
......@@ -41,7 +41,7 @@ long_name = "Resampling test of conditional essentiality between two conditions"
description = """Method for determining conditional essentiality based on resampling (i.e. permutation test). Identifies significant changes in mean read-counts for each gene after normalization."""
transposons = ["himar1", "tn5"]
columns = ["Orf","Name","Desc","Sites","Mean Ctrl","Mean Exp","log2FC", "Sum Ctrl", "Sum Exp", "Delta Sum","p-value","Adj. p-value"]
columns = ["Orf","Name","Desc","Sites","Mean Ctrl","Mean Exp","log2FC", "Sum Ctrl", "Sum Exp", "Delta Mean","p-value","Adj. p-value"]
class ResamplingAnalysis(base.TransitAnalysis):
def __init__(self):
......@@ -225,7 +225,7 @@ class ResamplingMethod(base.DualConditionMethod):
return None
#Validate transposon types
if not transit_tools.validate_filetypes(ctrldata+expdata, transposons):
if not transit_tools.validate_transposons_used(ctrldata+expdata, transposons):
return None
......@@ -317,10 +317,16 @@ class ResamplingMethod(base.DualConditionMethod):
def Run(self):
if not self.wxobj:
# Force matplotlib to use good backend for png.
matplotlib.use('Agg')
#if not self.wxobj:
# # Force matplotlib to use good backend for png.
# import matplotlib.pyplot as plt
#elif "matplotlib.pyplot" not in sys.modules:
try:
import matplotlib.pyplot as plt
except:
print "Error: cannot do histograms"
self.doHistogram = False
self.transit_message("Starting resampling Method")
start_time = time.time()
......@@ -340,7 +346,7 @@ class ResamplingMethod(base.DualConditionMethod):
Kexp = len(self.expdata)
#Get orf data
self.transit_message("Getting Data")
(data, position) = tnseq_tools.get_data(self.ctrldata+self.expdata)
(data, position) = transit_tools.get_validated_data(self.ctrldata+self.expdata, wxobj=self.wxobj)
(K,N) = data.shape
......@@ -380,17 +386,18 @@ class ResamplingMethod(base.DualConditionMethod):
data1 = gene.reads[:Kctrl,ii].flatten()+self.pseudocount
data2 = gene.reads[Kctrl:,ii].flatten()+self.pseudocount
(test_obs, mean1, mean2, log2FC, pval_ltail, pval_utail, pval_2tail, testlist) = stat_tools.resampling(data1, data2, S=self.samples, testFunc=stat_tools.F_sum_diff_flat, adaptive=self.adaptive)
(test_obs, mean1, mean2, log2FC, pval_ltail, pval_utail, pval_2tail, testlist) = stat_tools.resampling(data1, data2, S=self.samples, testFunc=stat_tools.F_mean_diff_flat, adaptive=self.adaptive)
if self.doHistogram:
import matplotlib.pyplot as plt
if testlist:
n, bins, patches = plt.hist(testlist, normed=1, facecolor='c', alpha=0.75, bins=100)
else:
n, bins, patches = plt.hist([0,0], normed=1, facecolor='c', alpha=0.75, bins=100)
plt.xlabel('Delta Sum')
plt.xlabel('Delta Mean')
plt.ylabel('Probability')
plt.title('%s - Histogram of Delta Sum' % gene.orf)
plt.title('%s - Histogram of Delta Mean' % gene.orf)
plt.axvline(test_obs, color='r', linestyle='dashed', linewidth=3)
plt.grid(True)
genePath = os.path.join(histPath, gene.orf +".png")
......
......@@ -233,16 +233,17 @@ class Tn5GapsMethod(base.SingleConditionMethod):
start_time = time.time()
self.transit_message("Getting data (May take a while)")
genes_obj = tnseq_tools.Genes(self.ctrldata, self.annotation_path, ignoreCodon=self.ignoreCodon, nterm=self.NTerminus, cterm=self.CTerminus)
# Combine all wigs
(data,position) = tnseq_tools.get_data_zero_fill(self.ctrldata)
(data,position) = transit_tools.get_validated_data(self.ctrldata, wxobj=self.wxobj)
combined = tnseq_tools.combine_replicates(data, method=self.replicates)
combined[combined < self.minread] = 0
counts = combined
counts[counts > 0] = 1
num_sites = counts.size
genes_obj = tnseq_tools.Genes(self.ctrldata, self.annotation_path, ignoreCodon=self.ignoreCodon, nterm=self.NTerminus, cterm=self.CTerminus, data=data, position=position)
pins = numpy.mean(counts)
pnon = 1.0 - pins
......
......@@ -305,8 +305,7 @@ install .whl (wheel) files:
pip.exe install wheel
Finally, install the transit package using pip:
Next install the transit package using pip:
::
......@@ -314,11 +313,35 @@ Finally, install the transit package using pip:
To use transit in GUI mode you will need to install wxPython versions 3.0 or earlier. We have provided .whl files which you can download and install below. (Note: Make sure to
choose the files that match your Windows version i.e. 32/64 bit)
+ `wxPython-3.0.2.0-cp27-none-win_amd64.whl <http://saclab.tamu.edu/essentiality/transit/wxPython-3.0.2.0-cp27-none-win_amd64.whl>`_ or `[32 bit] <http://saclab.tamu.edu/essentiality/transit/wxPython-3.0.2.0-cp27-none-win32.whl>`_
+ `wxPython_common-3.0.2.0-py2-none-any.whl <http://saclab.tamu.edu/essentiality/transit/wxPython_common-3.0.2.0-py2-none-any.whl>`_ or `[32 bit] <http://saclab.tamu.edu/essentiality/transit/wxPython_common-3.0.2.0-py2-none-any.whl>`_
Finally, install the files using pip:
::
pip.exe install wxPython-3.0.2.0-cp27-none-win_amd64.whl
pip.exe install wxPython_common-3.0.2.0-py2-none-any.whl
making sure to replace the name with the file you downloaded (i.e. 32bit vs 64 bit)
.. NOTE::
If you will be using the pre-processor, TPP, you will also need to install :ref:`install BWA <bwa-win>`.
Method 2: Install Source Locally
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
......
......@@ -307,7 +307,7 @@ class Genes:
#
def __init__(self, wigList, annotation, norm="nonorm", reps="All", minread=1, ignoreCodon = True, nterm=0.0, cterm=0.0, include_nc = False, data=[], position=[]):
def __init__(self, wigList, annotation, norm="nonorm", reps="All", minread=1, ignoreCodon = True, nterm=0.0, cterm=0.0, include_nc = False, data=[], position=[],genome="", transposon="himar1"):
"""Initializes the gene list based on the list of wig files and a prot_table.
This class helps define a list of Gene objects with attributes that
......@@ -349,7 +349,12 @@ class Genes:
orf2info = get_gene_info(self.annotation)
if not numpy.any(data):
if transposon.lower() == "himar1" and not genome:
(data, position) = get_data(self.wigList)
elif genome:
(data, position) = get_data_w_genome(self.wigList, genome)
else:
(data, position) = get_data_zero_fill(self.wigList)
ii_min = data < self.minread
data[ii_min] = 0
hash = get_pos_hash(self.annotation)
......@@ -708,10 +713,39 @@ def get_file_types(wig_list):
tmp = line.split()
pos = int(tmp[0])
rd = float(tmp[1])
if pos != prev_pos + 1: types[i] = 'himar1'
if pos != prev_pos + 1:
types[i] = 'himar1'
break
prev_pos = pos
return types
def check_wig_includes_zeros(wig_list):
"""Returns boolean list showing whether the given files include empty sites
(zero) or not.
Arguments:
wig_list (list): List of paths to wig files.
Returns:
list: List of boolean values.
"""
if not wig_list:
return []
includes = [False for i in range(len(wig_list))]
for i, wig_filename in enumerate(wig_list):
with open(wig_filename) as wig_file:
for line in wig_file:
if line[0] not in "0123456789": continue
tmp = line.split()
pos = int(tmp[0])
rd = float(tmp[1])
if rd == 0:
includes[i] = True
break
return includes
#
def get_unknown_file_types(wig_list, transposons):
......@@ -745,14 +779,25 @@ def get_data(wig_list):
.. seealso:: :class:`get_file_types` :class:`combine_replicates` :class:`get_data_zero_fill` :class:`pytransit.norm_tools.normalize_data`
"""
K = len(wig_list)
T = 0
# If empty just quickly return empty lists
if not wig_list:
return (numpy.zeros((1,0)), numpy.zeros(0), [])
for line in open(wig_list[0]):
# Check size of all wig file matches
size_list = []
for j,path in enumerate(wig_list):
T = 0
for line in open(path):
if line[0] not in "0123456789": continue
T+=1
size_list.append(T)
# If it doesn't match, report and error and quit
if sum(size_list) != (T * len(size_list)):
print "Error: Not all wig files have the same number of sites."
print " Make sure all .wig files come from the same strain."
sys.exit()
data = numpy.zeros((K,T))
position = numpy.zeros(T, dtype=int)
......@@ -766,7 +811,14 @@ def get_data(wig_list):
pos = int(tmp[0])
rd = float(tmp[1])
prev_pos = pos
try:
data[j,i] = rd
except Exception as e:
print "Error: %s" % e
print ""
print "Make sure that all wig files have the same number of TA sites (i.e. same strain)"
sys.exit()
position[i] = pos
i+=1
return (data, position)
......@@ -804,7 +856,7 @@ def get_data_zero_fill(wig_list):
return (numpy.zeros((1,0)), numpy.zeros(0), [])
data = numpy.zeros((K,T))
position = numpy.zeros(T)
position = numpy.array(range(T)) + 1#numpy.zeros(T)
for j,path in enumerate(wig_list):
reads = []
i = 0
......@@ -813,19 +865,43 @@ def get_data_zero_fill(wig_list):
tmp = line.split()
pos = int(tmp[0])
rd = float(tmp[1])
# Fill in remaining zeros
for fill_pos in range(i, pos - 1):
data[j,fill_pos] = 0
position[fill_pos] = i
i += 1
prev_pos = pos
data[j,i] = rd
position[i] = pos
data[j,pos-1] = rd
i+=1
return (data, position)
def get_data_w_genome(wig_list, genome):
X = read_genome(genome)
N = len(X)
positions = []
pos2index = {}
count = 0
for i in range(N-1):
if X[i:i+2].upper() == "TA":
pos = i+1
positions.append(pos)
pos2index[pos] = count
count +=1
positions = numpy.array(positions)
T = len(positions)
K = len(wig_list)
data = numpy.zeros((K,T))
for j,path in enumerate(wig_list):
for line in open(path):
if line[0] not in "0123456789": continue
tmp = line.split()
pos = int(tmp[0])
rd = float(tmp[1])
if pos in pos2index:
index = pos2index[pos]
data[j,index] = rd
else:
print "Warning: Coordinate %d did not match a TA site in the genome. Ignoring counts." %(pos)
return (data, positions)
#
def combine_replicates(data, method="Sum"):
......@@ -890,16 +966,7 @@ def get_wig_stats(path):
"""
(data,position) = get_data([path])
reads = data[0]
density = numpy.mean(reads>0)
meanrd = numpy.mean(reads)
nzmeanrd = numpy.mean(reads[reads>0])
nzmedianrd = numpy.median(reads[reads>0])
maxrd = numpy.max(reads)
totalrd = numpy.sum(reads)
skew = scipy.stats.skew(reads[reads>0])
kurtosis = scipy.stats.kurtosis(reads[reads>0])
return (density, meanrd, nzmeanrd, nzmedianrd, maxrd, totalrd, skew, kurtosis)
return get_data_stats(reads)
#
......@@ -1454,7 +1521,7 @@ if __name__ == "__main__":
print "#"
griffin_results = griffin_analysis(G, theta)
for i,gene in enumerate(sorted(G)):
for i,gene in enumerate(G):
pos = gene.position
exprun, pval = griffin_results[i][-2:]
print "%s\t%s\t%s\t%s\t%s\t%s\t%s\t%1.1f\t%1.5f" % (gene.orf, gene.name, gene.k, gene.n, gene.r, gene.s, gene.t, exprun, pval)
......
......@@ -21,6 +21,7 @@ try:
except Exception as e:
hasWx = False
newWx = False
print "EXCEPTION:", str(e)
import os
import time
......@@ -105,7 +106,7 @@ class MainFrame ( wx.Frame ):
self.SetSizeHintsSz( wx.DefaultSize, wx.DefaultSize )
#self.SetSizeHintsSz( wx.DefaultSize, wx.DefaultSize )
bSizer1 = wx.BoxSizer( wx.HORIZONTAL )
......@@ -720,7 +721,6 @@ class TnSeekFrame(MainFrame):
for dataset in ctrlData:
try:
path = os.path.dirname(os.path.realpath(__file__))
print path
path = os.path.join(os.path.dirname('/pacific/home/mdejesus/transit/src/transit.py'), "pytransit/data", dataset)
transit_tools.transit_message("Adding Ctrl File: " + path)
self.loadCtrlFile(path)
......@@ -1039,6 +1039,7 @@ class TnSeekFrame(MainFrame):
if dlg.ShowModal() == wx.ID_OK:
paths = dlg.GetPaths()
print "You chose the following Control file(s):"
print paths
for fullpath in paths:
print "\t%s" % fullpath
self.loadCtrlFile(fullpath)
......@@ -1935,4 +1936,61 @@ along with TRANSIT. If not, see <http://www.gnu.org/licenses/>.
traceback.print_exc()
class AssumeZerosDialog(wx.Dialog):
def __init__(self, *args, **kw):
self.ID_HIMAR1 = wx.NewId()
self.ID_TN5 = wx.NewId()
wx.Dialog.__init__(self, None, title="Dialog")
self.ID_HIMAR1 = wx.NewId()
self.ID_TN5 = wx.NewId()
self.SetSize((500, 300))
self.SetTitle("Warning: Wig Files Do Not Include Empty Sites")
mainSizer = wx.BoxSizer(wx.VERTICAL)
self.SetSizer(mainSizer)
warningText = """
One or more of your .wig files does not include any empty sites (i.e. sites with zero read-counts). The analysis methods in TRANSIT require knowing ALL possible insertion sites, even those without reads.
Please indicate how you want to proceed:
As Himar1: You will need to provide the DNA sequence (.fasta format) and TRANSIT will automatically determine empty TA sites.
As Tn5: TRANSIT will assume all nucleotides are possible insertion sites. Those not included in the .wig file are assumed to be zero.
"""
warningStaticBox = wx.StaticText(self, wx.ID_ANY, warningText, (-1,-1), (-1, -1), wx.ALL)
warningStaticBox.Wrap(480)
mainSizer.Add(warningStaticBox)
button_sizer = wx.BoxSizer(wx.HORIZONTAL)
himar1Button = wx.Button(self, self.ID_HIMAR1, label='Proceed as Himar1')
tn5Button = wx.Button(self, self.ID_TN5, label='Proceed as Tn5')
cancelButton = wx.Button(self, wx.ID_CANCEL, label='Cancel')
button_sizer.Add(himar1Button, flag=wx.LEFT, border=5)
button_sizer.Add(tn5Button, flag=wx.LEFT, border=5)
button_sizer.Add(cancelButton, flag=wx.LEFT, border=5)
mainSizer.Add(button_sizer,
flag=wx.ALIGN_CENTER|wx.TOP|wx.BOTTOM, border=10)
himar1Button.Bind(wx.EVT_BUTTON, self.OnClose)
tn5Button.Bind(wx.EVT_BUTTON, self.OnClose)
cancelButton.Bind(wx.EVT_BUTTON, self.OnClose)
def OnClose(self, event):
if self.IsModal():
self.EndModal(event.EventObject.Id)
else:
self.Close()