.gitignore

-# ignore other autotools generated content
-Makefile
-Makefile.in
-configure
-aclocal.m4
-autom4te.cache
-autoscan.log
-depcomp
-missing
-compile
-install-sh
-config
-config.*
-.deps
-stamp-h1
-.dirstamp
-ylwrap
-tests/test-env.sh
-src/ViennaRNA/vrna_config.h
-libtool
-
-# ignore libtoolize generated files
-m4/libtool.m4
-m4/lt*.m4
-
-# ignore all tar.gz archives
-*.tar.gz
-# except the libsvm sources
-!libsvm*.tar.gz
-
-# logfiles of test suites
-*.log
-
-# libtool generated files
-.libs
-*.la
-*.lo
-*.o
-
-# ignore pkg-config file
-RNAlib2.pc
-
-# ignore all postscript files that might be generated
-*.ps
-

.travis.yml

-dist: xenial
-
-compiler:
-- gcc
-- clang
-
-
-addons:
-  apt:
-    sources:
-    - ubuntu-toolchain-r-test
-    packages:
-    - gcc
-    - g++
-    - clang
-    - gengetopt
-    - flex
-    - help2man
-    - libgsl-dev
-    - doxygen
-    - doxygen-latex
-    - libperl-dev
-    - python-dev
-    - python3-dev
-    - graphviz
-    - texlive-latex-base
-    - texlive-latex-recommended
-    - texlive-latex-extra
-    - latex-beamer
-    - check
-    - texinfo
-    - diffutils
-
-before_script:
-- autoreconf -i
-
-
-install:
-  - wget https://github.com/swig/swig/archive/rel-3.0.12.tar.gz
-  - tar -xzvf rel-3.0.12.tar.gz
-  - pushd swig-rel-3.0.12 && ./autogen.sh && ./configure --prefix=/usr && make && sudo make install && popd
-
-
-script:
-- cd src && tar xzf libsvm-3.23.tar.gz && cd ..
-- ./configure --with-cluster --with-kinwalker --disable-lto
-- make -j${CPU_COUNT}
-- make check
-
-
-before_deploy:
-- make dist-gzip
-- make dist-zip
-- export DIST_GZIP=$(ls ViennaRNA-*.tar.gz)
-- export DIST_ZIP=$(ls ViennaRNA-*.zip)
-- echo "Deploying Changelog and autoconf's dists (${DIST_GZIP} and ${DIST_ZIP}) to GitHub releases"
-
-
-deploy:
-  provider: releases
-  api-key:
-    secure: OxTdQiX3QnfRvz34HsS1XYpxNVnTYEvmlFVln/KHAx1LbU94qD3YNuGQuhOYO11CH3OUU+PM02sAUXQW6gth9tgDIBj1uRmWhP0KU7UccfkK/8Q7OuaelaySvK4kZpHJOKWwRHxzA7KuVlSApLgvWIcqYxdY7HxJcceB14lBUDFzDd6YETWEiTdEQ/dRVHJFg6lejz0JWxEYSeOiGGwv6fMrLBviG3ct/WftVl1I+tK5ZpmeyJ3BkRKOb0UOSmFKJEgp8XYe+3pPaHP0jHB7t+6y/eVK2hi/2DeL2xvRCctjMU8HuGdBputAsyyE6TgafCPv5fccygyg1cIA+639siOkHJ8hidLR6YGk3TvMJAOcDhtqs85UtvrfPUirD66vd6HNnvJMfoHuSwYQ61/t2jKvPGKzr3OJzZrPNWrt0rVVO+Q9lQ0+HPvp0rn79NN39JntxM4Fxy5YQd+DuPRdlvtEzcA3XWKLAH1L7urYlVlok5Ep1W8o5yE4FfNWjRj6BFivw7EhX7gS898B6Qx45pNUdHWQZVWxytNKSv5i1tkCvMbBHaJgk59luun/wlppfl7/KYyT8wsGYfC1AE1+aiT7R/tsW9mm9QDwRN2VETTLUZyQDlzVEgv3jKqNkUfZPGdKMxD60Pipdxv4qn0ZeSF2ol1rO8SP09QYgPuOCwY=
-  skip_cleanup: true
-  file_glob: true
-  overwrite: true
-  file:
-  - "${DIST_GZIP}"
-  - "${DIST_ZIP}"
-  - CHANGELOG.md
-  on:
-    repo: ViennaRNA/ViennaRNA
-    tags: true

CHANGELOG.md

@@ -4,7 +4,45 @@ Below, you'll find a list of notable changes for each version of the ViennaRNA P
 
 ## Version 2.4.x
 
-### [Unreleased](https://github.com/ViennaRNA/ViennaRNA/compare/v2.4.13...HEAD)
+### [Unreleased](https://github.com/ViennaRNA/ViennaRNA/compare/v2.4.14...HEAD)
+
+
+### [Version 2.4.14](https://github.com/ViennaRNA/ViennaRNA/compare/v2.4.13...v2.4.14) (Release date: 2019-08-13)
+
+#### Programs
+  * Fix `RNApvmin` pertubation vector computation
+  * Add non-redundant sampling option to `RNApvmin`
+  * Add `RNAdos` program to compute density of states
+  * Add `-P DNA` convenience command line parameter to most programs to quickly load DNA parameters without any input file
+  * MAN: Add example section to man-page of `RNAalifold`
+
+#### Library
+  * API: Fix memory leak in `vrna_path_gradient()`
+  * API: Fix release of memory fir `vrna_sequence_remove_all()`
+  * API: Fix soft-constraints application in `vrna_sc_minimize_pertubation()` that prevented proper computation of the pertubation vector
+  * API: Add 5' and 3' neighbor nucleotide encoding arrays and name string to `vrna_seq_t`
+  * API: Add new data structure for multiple sequence alignments
+  * API: Add `vrna_sequence_order_update()` function
+  * API: Add non-redundant sampling mode to `vrna_sc_minimize_pertubation()` through passing negative sample-sizes
+  * API: Add v3.0 API functions for maximum expected accuracy (MEA) computation
+  * API: Include energy parameter sets into `RNAlib` and provide functions to load them at runtime
+  * API: Prepare sequence data in `vrna_fold_compound_t` with `vrna_sequence_add()`
+  * API: Use `vrna_pbacktrack_num()` instead of `vrna_pbacktrack()` in `vrna_sc_minimize_pertubation()` to speed-up sample generation
+  * Reduce use of global variable `cut_point` in `RNAlib`
+  * SWIG: Use `importlib` in favor of `imp` to determine Python 3 tag extension
+  * SWIG: Update various wrapper functions
+  * SWIG: Add wrappers for MEA computation with `vrna_MEA()` and `vrna_MEA_from_plist`
+  * SWIG: Add wrappers for `vrna_pr_structure()` and `vrna_pr_energy()`
+
+#### Package
+  * REFMAN: Fix LaTeX code in `units.h` that prevented proper compilation with `pdflatex`
+  * Add an R script to create 2D landscape plots from `RNA2Dfold` output
+  * Add `gengetopt` to configure-time requirements to build man-pages
+  * Add new energy parameter file `rna_misc_special_hairpins.par` with additional UV-melting derived parameters for Tri- and Tetra-loops
+  * Update RNA Tutorial
+  * Colorize final configure script message
+  * REFMAN: Always use `pdflatex` to compile reference manual and tutorial
+  * EXAMPLES: Add Python script that performs computations equivalent to `RNAfold -p --MEA`
 
 
 ### [Version 2.4.13](https://github.com/ViennaRNA/ViennaRNA/compare/v2.4.12...v2.4.13) (Release date: 2019-05-30)

CONTRIBUTING.md

-# Contributing
-
-If you wish to contribute to this project, please first discuss any proposed changes
-with the owners and main developers. You may do that either through making an issue
-at our official GitHub presence https://github.com/ViennaRNA/ViennaRNA, by email
-(rna@tbi.univie.ac.at), or any other personal communication with the core developer
-team.
-
-Please note that we have a code of conduct. Please follow it in all your interactions
-with this project.
-
-## Reporting Bugs
-
-1. Please make an issue at GitHub or notify us by emailing to rna@tbi.univie.ac.at
-2. In your report, include as much information as possible, such that we are able
-   to reproduce it. If possible, find a minimal example that triggers the bug.
-3. Include the version number for the ViennaRNA Package you experience the bug with.
-4. Include at least some minimal information regarding your operating system (Linux,
-   Mac OS X, Windows, etc.)
-
-## Pull Request Process
-
-1. Ensure that you have not checked-in any files that are automatically build!
-2. When contributing C source code, follow our code formatting guide lines. You
-   may use the tool `uncrustify` together with our config located in `misc/uncrustify.cfg`
-   to accomplish that.
-3. Only expose symbols (functions, variables, etc.) to the libraries interface that are
-   absolutely necessary! Hide all other symbols in the corresponding object file(s) by
-   declaring them as `static`.
-4. Use the prefixes `vrna_` for any symbol you add to the API of our library! Preprocessor
-   macros in header files require the prefix in capital letters, i.e. `VRNA_`.
-5. Use C-style comments at any place necessary to make sure your implementation can still
-   be understood and followed in the future.
-6. Add test cases for any new implementation! The test suite is located in the `tests`
-   directory and is split into tests for the C-library, executable programs, and the
-   individual scripting language interfaces.
-7. Run `make check` to ensure that all other test suites still run properly with your
-   applied changes!
-8. When contributing via GitHub, make a personal fork of our project and create a separate
-   branch for your changes. Then make a pull request to our `user-contrib` branch.
-   Pull requests to the `master` branch will be rejected to keep its history clean.
-9. Pull requests that have been successfully merged into the `user-contrib` branch
-   usually find their way into the next release of the ViennaRNA Package. However, please
-   note that the core developers may decide to include your changes in a later version.

README.md

@@ -70,8 +70,8 @@ and installation process.*
 
 Usually you'll simply unpack the distribution tarball, configure and make:
 ```
-tar -zxvf ViennaRNA-2.4.13.tar.gz
-cd ViennaRNA-2.4.13
+tar -zxvf ViennaRNA-2.4.14.tar.gz
+cd ViennaRNA-2.4.14
 ./configure
 make
 sudo make install
@@ -278,6 +278,7 @@ The ViennaRNA Package includes the following executable programs:
 | `RNAalifold`    | Calculate secondary structures for a set of aligned RNA sequences                                                         |
 | `RNAcofold`     | Calculate secondary structures of two RNAs with dimerization                                                              |
 | `RNAdistance`   | Calculate distances between RNA secondary structures                                                                      |
+| `RNAdos`        | Compute the density of states for the conformation space of a given RNA sequence                                          |
 | `RNAduplex`     | Compute the structure upon hybridization of two RNA strands                                                               |
 | `RNAeval`       | Evaluate free energy of RNA sequences with given secondary structure                                                      |
 | `RNAfold`       | Calculate minimum free energy secondary structures and partition function of RNAs                                         |

RNA-Tutorial/.gitignore

-*.aux
-*.dvi
-*.log
-*~
-*.png
-*.html
-*-eps-converted-to.pdf
-

RNA-Tutorial/Data/hard_const_example.fa

+>my_constrained_sequence
+GCCCUUGUCGAGAGGAACUCGAGACACCCACUACCCACUGAGGACUUUCG
+..((((.....))))

RNA-Tutorial/Data/test.const

+F 1 0 5
+C 6 0 3 M